Incidental Mutation 'R8160:Snai2'
ID633487
Institutional Source Beutler Lab
Gene Symbol Snai2
Ensembl Gene ENSMUSG00000022676
Gene Namesnail family zinc finger 2
SynonymsSnail2, Slug, Slugh
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.861) question?
Stock #R8160 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location14705852-14709385 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14706804 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 58 (V58A)
Ref Sequence ENSEMBL: ENSMUSP00000023356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023356]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023356
AA Change: V58A

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000023356
Gene: ENSMUSG00000022676
AA Change: V58A

DomainStartEndE-ValueType
PDB:3W5K|B 1 59 4e-6 PDB
low complexity region 60 84 N/A INTRINSIC
low complexity region 88 105 N/A INTRINSIC
ZnF_C2H2 129 151 4.17e-3 SMART
ZnF_C2H2 160 182 6.88e-4 SMART
ZnF_C2H2 186 208 7.26e-3 SMART
ZnF_C2H2 214 236 9.88e-5 SMART
ZnF_C2H2 242 269 6.15e1 SMART
Meta Mutation Damage Score 0.1011 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Snail family of C2H2-type zinc finger transcription factors. The encoded protein acts as a transcriptional repressor that binds to E-box motifs and is also likely to repress E-cadherin transcription in breast carcinoma. This protein is involved in epithelial-mesenchymal transitions and has antiapoptotic activity. Mutations in this gene may be associated with sporatic cases of neural tube defects. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in growth retardation and eyelid deformities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415F15Rik T C 11: 11,487,734 S246P unknown Het
Adam12 C T 7: 133,968,041 probably null Het
Aldh8a1 A G 10: 21,395,791 D472G possibly damaging Het
Appl1 T C 14: 26,928,635 I527V probably benign Het
Arhgef4 C A 1: 34,723,574 T637K unknown Het
Atp7b G A 8: 21,997,559 A1273V probably damaging Het
Ccl20 T A 1: 83,117,822 S35T Het
Cdh24 C A 14: 54,638,489 V208F probably damaging Het
Dchs2 A T 3: 83,270,805 Q1055L probably benign Het
Dock8 G A 19: 25,147,347 R1009Q probably damaging Het
Ext2 A T 2: 93,813,762 V58E probably benign Het
Fam208a T A 14: 27,449,956 N420K probably damaging Het
Fam209 A T 2: 172,472,725 I45F possibly damaging Het
Hfm1 T C 5: 106,896,033 Y579C probably null Het
Hipk4 C T 7: 27,523,761 A82V possibly damaging Het
Il17rc A G 6: 113,476,528 Y223C possibly damaging Het
Itsn1 G A 16: 91,818,558 R397H unknown Het
Kdm5b T A 1: 134,613,919 M744K probably damaging Het
Mettl16 T C 11: 74,817,679 V568A probably damaging Het
Mink1 C T 11: 70,606,081 Q422* probably null Het
Mvb12b G T 2: 33,840,222 D81E probably benign Het
Nostrin A T 2: 69,179,466 I313F probably damaging Het
Nsun6 A G 2: 15,009,408 probably null Het
Nt5dc1 T A 10: 34,324,396 E209V possibly damaging Het
Oasl2 T C 5: 114,901,286 probably benign Het
Olfr303 C T 7: 86,395,265 V78M possibly damaging Het
Olfr517 C T 7: 108,868,788 R122Q possibly damaging Het
Olfr857 T A 9: 19,712,789 probably benign Het
Ppm1h A T 10: 122,802,436 T204S probably benign Het
Rad51b T A 12: 79,303,341 L70I probably benign Het
Smok3c A G 5: 138,065,024 T258A possibly damaging Het
St6galnac1 G A 11: 116,775,490 probably benign Het
Other mutations in Snai2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Snai2 APN 16 14706771 missense probably benign 0.02
IGL03295:Snai2 APN 16 14706774 missense possibly damaging 0.64
IGL03412:Snai2 APN 16 14707256 missense possibly damaging 0.91
R0765:Snai2 UTSW 16 14706804 missense possibly damaging 0.85
R0766:Snai2 UTSW 16 14708247 missense possibly damaging 0.71
R1419:Snai2 UTSW 16 14708180 missense possibly damaging 0.85
R1669:Snai2 UTSW 16 14707044 missense possibly damaging 0.95
R2096:Snai2 UTSW 16 14706997 missense possibly damaging 0.86
R2496:Snai2 UTSW 16 14706002 missense possibly damaging 0.86
R2901:Snai2 UTSW 16 14705983 missense possibly damaging 0.93
R4682:Snai2 UTSW 16 14708286 missense probably benign
R4832:Snai2 UTSW 16 14707017 missense probably damaging 0.97
R4879:Snai2 UTSW 16 14706741 missense probably benign
R5025:Snai2 UTSW 16 14708189 missense possibly damaging 0.95
R5794:Snai2 UTSW 16 14706726 missense probably benign
R6143:Snai2 UTSW 16 14708243 nonsense probably null
R6980:Snai2 UTSW 16 14708249 missense possibly damaging 0.92
R7096:Snai2 UTSW 16 14707164 missense possibly damaging 0.93
R7121:Snai2 UTSW 16 14707106 missense probably benign 0.00
R7501:Snai2 UTSW 16 14706890 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- ATGGAGTCTCCTGCATGTTG -3'
(R):5'- TCTCAGCTTCGATGGCATGG -3'

Sequencing Primer
(F):5'- CTGCATGTTGTTATGGTCTCTCTCAG -3'
(R):5'- CATGGGGGTCTGAAAGCTTG -3'
Posted On2020-07-13