Incidental Mutation 'R0106:Mdga2'
ID 63349
Institutional Source Beutler Lab
Gene Symbol Mdga2
Ensembl Gene ENSMUSG00000034912
Gene Name MAM domain containing glycosylphosphatidylinositol anchor 2
Synonyms 6720489L24Rik, Mdga2, Adp, 9330209L04Rik, Mamdc1
MMRRC Submission 038392-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0106 (G1)
Quality Score 143
Status Validated
Chromosome 12
Chromosomal Location 66512834-67269323 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 66763480 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 205 (N205K)
Ref Sequence ENSEMBL: ENSMUSP00000152613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037181] [ENSMUST00000222167] [ENSMUST00000223141]
AlphaFold P60755
Predicted Effect probably damaging
Transcript: ENSMUST00000037181
AA Change: N274K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046761
Gene: ENSMUSG00000034912
AA Change: N274K

DomainStartEndE-ValueType
IGc2 122 186 1.38e-15 SMART
IG 213 307 1.79e0 SMART
IGc2 324 386 1.56e-14 SMART
IGc2 419 493 4.43e-5 SMART
low complexity region 495 507 N/A INTRINSIC
IGc2 525 591 1.97e-11 SMART
IG_like 621 687 2.5e0 SMART
Blast:FN3 707 795 4e-40 BLAST
MAM 812 990 3.4e-49 SMART
transmembrane domain 999 1021 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101379
SMART Domains Protein: ENSMUSP00000098930
Gene: ENSMUSG00000034912

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1cs6a1 40 72 2e-5 SMART
Blast:IG 47 72 9e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177690
Predicted Effect probably damaging
Transcript: ENSMUST00000178814
AA Change: N264K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137608
Gene: ENSMUSG00000034912
AA Change: N264K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 53 117 1.38e-15 SMART
IG 144 238 1.79e0 SMART
IGc2 255 317 1.56e-14 SMART
IGc2 350 424 4.43e-5 SMART
low complexity region 426 438 N/A INTRINSIC
IGc2 456 522 1.97e-11 SMART
IG_like 552 618 2.5e0 SMART
Blast:FN3 638 726 3e-40 BLAST
MAM 736 914 1.38e-49 SMART
transmembrane domain 923 945 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000222167
AA Change: N205K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000223141
AA Change: N205K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1271 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 100% (84/84)
MGI Phenotype PHENOTYPE: Mice that paternally inherit an allele disrupted by transgene insertion exhibit varying degrees of abnormalities in the skull, paw, and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730018C14Rik A T 12: 112,381,628 (GRCm39) noncoding transcript Het
Abcb9 T C 5: 124,221,123 (GRCm39) N276S possibly damaging Het
Arhgef25 A G 10: 127,019,879 (GRCm39) probably null Het
Asic4 T C 1: 75,427,771 (GRCm39) V99A probably benign Het
Aspm C A 1: 139,404,614 (GRCm39) Q1315K probably benign Het
B3galnt2 T C 13: 14,170,378 (GRCm39) S243P probably benign Het
Brf1 A G 12: 112,937,083 (GRCm39) probably benign Het
Card19 A C 13: 49,361,621 (GRCm39) D3E probably benign Het
Chd6 A G 2: 160,809,822 (GRCm39) F1480L probably damaging Het
Ckap5 T C 2: 91,408,550 (GRCm39) I915T possibly damaging Het
Ckap5 T A 2: 91,446,185 (GRCm39) I1836N probably damaging Het
Cpb1 T C 3: 20,320,697 (GRCm39) probably null Het
Cramp1 A G 17: 25,191,350 (GRCm39) V1037A probably benign Het
Cspg5 C A 9: 110,075,600 (GRCm39) P112Q probably damaging Het
Cyp2g1 T A 7: 26,513,607 (GRCm39) I182N probably damaging Het
Dscc1 C A 15: 54,946,966 (GRCm39) C253F probably benign Het
Dysf C A 6: 84,090,318 (GRCm39) F956L probably benign Het
Ephb6 T C 6: 41,596,528 (GRCm39) probably benign Het
Firrm T C 1: 163,810,380 (GRCm39) probably benign Het
Fkbp6 C T 5: 135,368,858 (GRCm39) R234Q probably benign Het
Gda T C 19: 21,374,920 (GRCm39) D332G probably benign Het
Ggt7 C T 2: 155,336,813 (GRCm39) A560T possibly damaging Het
Glis3 A T 19: 28,509,268 (GRCm39) S239T possibly damaging Het
Gm10845 T A 14: 80,100,644 (GRCm39) noncoding transcript Het
H2-M5 A G 17: 37,300,034 (GRCm39) F47L possibly damaging Het
Hsdl1 T A 8: 120,292,517 (GRCm39) S254C probably damaging Het
Igsf6 T A 7: 120,673,677 (GRCm39) I18F probably benign Het
Immt A G 6: 71,828,828 (GRCm39) S128G probably benign Het
Isy1 G A 6: 87,796,167 (GRCm39) R257W probably damaging Het
Kif13a G T 13: 46,978,823 (GRCm39) probably benign Het
Kif14 T C 1: 136,407,662 (GRCm39) probably benign Het
L2hgdh A T 12: 69,752,563 (GRCm39) Y239* probably null Het
Lama3 T C 18: 12,537,039 (GRCm39) V228A probably damaging Het
Lamp1 A G 8: 13,224,550 (GRCm39) T405A probably damaging Het
Lpin1 A T 12: 16,590,980 (GRCm39) N817K possibly damaging Het
Luzp1 A G 4: 136,269,996 (GRCm39) K740E probably damaging Het
Mapk12 T C 15: 89,017,187 (GRCm39) probably benign Het
Myo1a A G 10: 127,555,749 (GRCm39) I913V probably benign Het
Nat10 A G 2: 103,587,550 (GRCm39) V55A probably damaging Het
Nlrp10 T C 7: 108,524,529 (GRCm39) E317G possibly damaging Het
Nomo1 T C 7: 45,687,056 (GRCm39) I72T probably damaging Het
Or5b98 A G 19: 12,931,720 (GRCm39) I256V probably benign Het
Or8d6 GC G 9: 39,854,119 (GRCm39) probably null Het
Pappa2 C T 1: 158,542,547 (GRCm39) C1780Y probably damaging Het
Pgm2l1 A G 7: 99,899,580 (GRCm39) M65V probably benign Het
Plec C T 15: 76,060,518 (GRCm39) E3162K probably damaging Het
Pnisr T C 4: 21,874,617 (GRCm39) probably benign Het
Pop7 A G 5: 137,499,911 (GRCm39) *141Q probably null Het
Prss34 A T 17: 25,517,700 (GRCm39) D25V probably damaging Het
Ptpn1 T C 2: 167,818,338 (GRCm39) probably benign Het
Pygb A G 2: 150,648,123 (GRCm39) D119G probably benign Het
Racgap1 T C 15: 99,540,839 (GRCm39) T4A possibly damaging Het
Rap1gap2 A G 11: 74,326,570 (GRCm39) C166R probably benign Het
Rbm28 C A 6: 29,127,802 (GRCm39) V705L probably benign Het
Rgs1 C T 1: 144,124,287 (GRCm39) V50M probably benign Het
Rgs12 C T 5: 35,124,008 (GRCm39) T597I probably benign Het
Ros1 T C 10: 52,018,363 (GRCm39) N765S possibly damaging Het
Ruvbl1 A G 6: 88,450,182 (GRCm39) R58G probably damaging Het
Scube2 A G 7: 109,446,115 (GRCm39) probably benign Het
Serpinb10 T A 1: 107,474,474 (GRCm39) L212Q probably damaging Het
Slc6a7 A G 18: 61,135,295 (GRCm39) V411A probably benign Het
Slco1a6 A T 6: 142,103,116 (GRCm39) probably benign Het
Smc1b A T 15: 84,955,020 (GRCm39) D1077E probably damaging Het
Srek1 G A 13: 103,880,131 (GRCm39) H476Y unknown Het
Strn3 A G 12: 51,668,571 (GRCm39) V673A probably benign Het
Tepsin T C 11: 119,982,637 (GRCm39) probably null Het
Timmdc1 A C 16: 38,342,724 (GRCm39) L58R probably damaging Het
Tmem132c T C 5: 127,631,733 (GRCm39) V664A possibly damaging Het
Tmem241 A T 18: 12,239,066 (GRCm39) probably benign Het
Tmprss15 T C 16: 78,800,277 (GRCm39) D602G probably damaging Het
Trbv15 T C 6: 41,118,199 (GRCm39) probably benign Het
Wdr70 A T 15: 8,049,068 (GRCm39) probably null Het
Other mutations in Mdga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Mdga2 APN 12 66,769,883 (GRCm39) missense probably damaging 0.97
IGL01632:Mdga2 APN 12 66,676,672 (GRCm39) splice site probably benign
IGL01843:Mdga2 APN 12 66,769,905 (GRCm39) critical splice acceptor site probably null
IGL02230:Mdga2 APN 12 66,702,197 (GRCm39) nonsense probably null
IGL02348:Mdga2 APN 12 66,597,349 (GRCm39) missense probably damaging 1.00
IGL02473:Mdga2 APN 12 66,597,385 (GRCm39) missense possibly damaging 0.73
IGL02795:Mdga2 APN 12 66,736,206 (GRCm39) missense probably benign 0.00
IGL02901:Mdga2 APN 12 66,844,583 (GRCm39) splice site probably benign
IGL03373:Mdga2 APN 12 66,763,496 (GRCm39) missense probably damaging 0.99
PIT4362001:Mdga2 UTSW 12 66,844,542 (GRCm39) missense possibly damaging 0.83
PIT4377001:Mdga2 UTSW 12 66,763,469 (GRCm39) missense probably damaging 0.99
R0106:Mdga2 UTSW 12 66,763,480 (GRCm39) missense probably damaging 1.00
R0110:Mdga2 UTSW 12 66,517,700 (GRCm39) missense possibly damaging 0.66
R0218:Mdga2 UTSW 12 66,701,894 (GRCm39) missense probably damaging 1.00
R0450:Mdga2 UTSW 12 66,517,700 (GRCm39) missense possibly damaging 0.66
R0801:Mdga2 UTSW 12 66,533,507 (GRCm39) missense probably damaging 1.00
R0847:Mdga2 UTSW 12 66,769,854 (GRCm39) missense probably damaging 1.00
R1056:Mdga2 UTSW 12 66,769,894 (GRCm39) missense probably damaging 0.97
R1086:Mdga2 UTSW 12 66,552,876 (GRCm39) splice site probably benign
R1335:Mdga2 UTSW 12 66,763,516 (GRCm39) splice site probably null
R1382:Mdga2 UTSW 12 66,517,690 (GRCm39) missense possibly damaging 0.68
R1490:Mdga2 UTSW 12 66,844,530 (GRCm39) missense probably benign 0.01
R1521:Mdga2 UTSW 12 66,615,700 (GRCm39) missense probably benign 0.00
R1556:Mdga2 UTSW 12 66,597,367 (GRCm39) missense possibly damaging 0.92
R1676:Mdga2 UTSW 12 66,615,547 (GRCm39) nonsense probably null
R1676:Mdga2 UTSW 12 66,615,546 (GRCm39) missense probably damaging 1.00
R1698:Mdga2 UTSW 12 66,736,109 (GRCm39) missense probably damaging 0.97
R1954:Mdga2 UTSW 12 66,533,482 (GRCm39) splice site probably benign
R2069:Mdga2 UTSW 12 66,615,691 (GRCm39) nonsense probably null
R2077:Mdga2 UTSW 12 66,702,136 (GRCm39) missense probably damaging 1.00
R2118:Mdga2 UTSW 12 66,915,526 (GRCm39) missense probably damaging 1.00
R2146:Mdga2 UTSW 12 66,915,515 (GRCm39) missense probably damaging 1.00
R2158:Mdga2 UTSW 12 66,736,155 (GRCm39) missense possibly damaging 0.64
R2189:Mdga2 UTSW 12 66,519,970 (GRCm39) splice site probably null
R2293:Mdga2 UTSW 12 66,615,759 (GRCm39) nonsense probably null
R2886:Mdga2 UTSW 12 66,553,044 (GRCm39) splice site probably benign
R2960:Mdga2 UTSW 12 66,676,752 (GRCm39) nonsense probably null
R3937:Mdga2 UTSW 12 67,267,980 (GRCm39) unclassified probably benign
R4437:Mdga2 UTSW 12 66,519,972 (GRCm39) splice site probably null
R4514:Mdga2 UTSW 12 66,763,496 (GRCm39) missense probably damaging 0.99
R4693:Mdga2 UTSW 12 66,844,407 (GRCm39) missense possibly damaging 0.81
R4719:Mdga2 UTSW 12 66,517,775 (GRCm39) unclassified probably benign
R4744:Mdga2 UTSW 12 66,844,501 (GRCm39) missense probably benign 0.01
R4756:Mdga2 UTSW 12 66,844,427 (GRCm39) missense probably damaging 1.00
R4781:Mdga2 UTSW 12 66,844,396 (GRCm39) splice site probably null
R5022:Mdga2 UTSW 12 66,517,534 (GRCm39) missense possibly damaging 0.83
R5108:Mdga2 UTSW 12 66,533,515 (GRCm39) missense probably benign 0.43
R5479:Mdga2 UTSW 12 66,701,950 (GRCm39) missense probably damaging 1.00
R5710:Mdga2 UTSW 12 66,553,556 (GRCm39) missense probably damaging 1.00
R5816:Mdga2 UTSW 12 66,701,956 (GRCm39) missense probably damaging 1.00
R5822:Mdga2 UTSW 12 66,702,109 (GRCm39) missense probably damaging 1.00
R5996:Mdga2 UTSW 12 66,844,537 (GRCm39) missense probably benign 0.00
R6038:Mdga2 UTSW 12 66,676,827 (GRCm39) missense probably damaging 1.00
R6038:Mdga2 UTSW 12 66,676,827 (GRCm39) missense probably damaging 1.00
R6297:Mdga2 UTSW 12 66,553,027 (GRCm39) missense probably damaging 1.00
R6484:Mdga2 UTSW 12 66,676,843 (GRCm39) missense possibly damaging 0.90
R6830:Mdga2 UTSW 12 66,769,775 (GRCm39) missense probably damaging 1.00
R6912:Mdga2 UTSW 12 66,552,889 (GRCm39) missense probably benign 0.01
R6971:Mdga2 UTSW 12 66,597,335 (GRCm39) missense probably damaging 1.00
R7053:Mdga2 UTSW 12 66,736,158 (GRCm39) missense probably benign 0.41
R7069:Mdga2 UTSW 12 66,533,526 (GRCm39) missense probably benign 0.31
R7381:Mdga2 UTSW 12 66,615,670 (GRCm39) missense probably benign 0.44
R7474:Mdga2 UTSW 12 66,533,535 (GRCm39) nonsense probably null
R7559:Mdga2 UTSW 12 66,520,003 (GRCm39) missense probably damaging 1.00
R7581:Mdga2 UTSW 12 66,553,029 (GRCm39) missense probably damaging 0.99
R7596:Mdga2 UTSW 12 66,552,897 (GRCm39) missense probably damaging 0.99
R7745:Mdga2 UTSW 12 66,736,125 (GRCm39) missense possibly damaging 0.63
R7745:Mdga2 UTSW 12 66,736,124 (GRCm39) missense probably damaging 0.99
R7852:Mdga2 UTSW 12 66,517,724 (GRCm39) missense possibly damaging 0.66
R8144:Mdga2 UTSW 12 66,702,037 (GRCm39) missense probably damaging 1.00
R8319:Mdga2 UTSW 12 67,267,803 (GRCm39) missense unknown
R8715:Mdga2 UTSW 12 66,915,526 (GRCm39) missense probably damaging 1.00
R8977:Mdga2 UTSW 12 66,844,409 (GRCm39) missense possibly damaging 0.88
R9138:Mdga2 UTSW 12 66,615,663 (GRCm39) missense possibly damaging 0.89
R9177:Mdga2 UTSW 12 66,517,481 (GRCm39) missense possibly damaging 0.66
R9223:Mdga2 UTSW 12 66,615,634 (GRCm39) missense possibly damaging 0.81
R9248:Mdga2 UTSW 12 66,736,226 (GRCm39) missense possibly damaging 0.87
R9264:Mdga2 UTSW 12 66,560,057 (GRCm39) missense probably damaging 1.00
R9381:Mdga2 UTSW 12 66,597,304 (GRCm39) missense possibly damaging 0.64
R9456:Mdga2 UTSW 12 66,615,532 (GRCm39) missense probably benign 0.44
R9633:Mdga2 UTSW 12 66,736,206 (GRCm39) missense probably benign 0.00
Z1176:Mdga2 UTSW 12 66,736,217 (GRCm39) missense probably damaging 1.00
Z1186:Mdga2 UTSW 12 66,615,727 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGCTTTGCAACCATAAGGCATTTTCAG -3'
(R):5'- TGCTAGAAGTAGGCTTTCCTCCCC -3'

Sequencing Primer
(F):5'- TAGCTATCAACTGGCCTATAAGAAGG -3'
(R):5'- CTCTAAGCATATTCCAGTATTATGCG -3'
Posted On 2013-07-30