Incidental Mutation 'R8161:Olfr12'
ID633492
Institutional Source Beutler Lab
Gene Symbol Olfr12
Ensembl Gene ENSMUSG00000061616
Gene Nameolfactory receptor 12
SynonymsGA_x6K02T2R7CC-81134096-81133095, MOR208-5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R8161 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location92617788-92623412 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 92620356 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 150 (R150H)
Ref Sequence ENSEMBL: ENSMUSP00000080027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081274]
Predicted Effect probably benign
Transcript: ENSMUST00000081274
AA Change: R150H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000080027
Gene: ENSMUSG00000061616
AA Change: R150H

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
Pfam:7tm_4 38 314 8e-53 PFAM
Pfam:7tm_1 48 297 1.3e-17 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik T C 9: 101,938,769 L51P probably damaging Het
Adgrb3 A T 1: 25,093,922 M1121K probably benign Het
Ank2 T C 3: 127,032,129 N371S Het
Arhgef5 T A 6: 43,283,951 C1437S probably damaging Het
Atp8b1 A T 18: 64,556,987 L558Q probably damaging Het
Bsn T C 9: 108,139,530 K94R probably benign Het
Cacna2d1 T A 5: 16,314,937 V435D probably damaging Het
Chd3 T C 11: 69,350,885 N1474S probably damaging Het
Chd7 A G 4: 8,855,038 D2089G probably damaging Het
Col11a2 T A 17: 34,051,290 M492K unknown Het
Col16a1 A T 4: 130,060,469 T502S unknown Het
Csl A T 10: 99,758,320 N294K probably damaging Het
Dnah5 T A 15: 28,350,704 M2624K possibly damaging Het
Dync1li1 C A 9: 114,706,183 H172N probably damaging Het
Eef1a1 C T 9: 78,480,390 V59I probably benign Het
Ephb1 T C 9: 102,194,813 K256E probably damaging Het
Erlin2 C A 8: 27,028,942 T78N probably damaging Het
Fbxo10 A G 4: 45,044,793 L614P probably damaging Het
Fer1l4 A T 2: 156,024,635 D1555E probably benign Het
Gabrr2 A G 4: 33,082,566 D230G probably damaging Het
Gen1 A T 12: 11,241,464 S840T probably benign Het
Glyctk G A 9: 106,157,693 T58I probably benign Het
Gm10471 T C 5: 26,084,692 S246G possibly damaging Het
Gm12258 G A 11: 58,859,312 A438T unknown Het
Gm14305 A G 2: 176,721,505 T397A probably benign Het
Hnrnpu G T 1: 178,337,502 R24S possibly damaging Het
Iffo2 A G 4: 139,574,954 N3D possibly damaging Het
Insr C T 8: 3,258,660 M125I probably damaging Het
Itsn1 G A 16: 91,818,558 R397H unknown Het
Kcnj16 T A 11: 111,024,515 M1K probably null Het
Kcns3 G A 12: 11,119,763 probably benign Het
Kmt2c A G 5: 25,374,564 V578A probably benign Het
Krt79 T C 15: 101,930,702 K444R probably damaging Het
Mtg2 T C 2: 180,085,575 V340A probably benign Het
Mtr A C 13: 12,221,486 L618R probably damaging Het
Myo6 T A 9: 80,217,709 D23E unknown Het
Nos1ap A G 1: 170,390,759 V27A probably damaging Het
Npc1 A T 18: 12,195,072 I1060K possibly damaging Het
Nrbp1 T A 5: 31,243,849 L23* probably null Het
Olfr1113 T C 2: 87,213,804 I304T probably damaging Het
Olfr147 C A 9: 38,403,507 T211K probably damaging Het
Olfr406 A T 11: 74,269,718 M110L probably benign Het
Olfr804 A T 10: 129,704,884 K2I possibly damaging Het
Pcdhgc5 A T 18: 37,821,562 T630S probably damaging Het
Pgm1 C A 5: 64,112,160 T530K probably damaging Het
Phf20l1 A T 15: 66,604,073 N185I probably damaging Het
Pkp2 A G 16: 16,213,449 D26G probably damaging Het
Rangap1 C T 15: 81,710,495 E378K probably benign Het
Rapgef1 A C 2: 29,679,198 I43L probably benign Het
Rbfox1 A G 16: 7,277,028 T111A Het
Rptn GCAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCA GCAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCA 3: 93,396,693 probably benign Het
Spata16 A T 3: 26,840,662 M287L probably benign Het
Stau2 A G 1: 16,345,825 M470T probably benign Het
Tcf12 T C 9: 72,015,651 Y70C probably damaging Het
Tsc22d1 C T 14: 76,417,020 T313M probably benign Het
Vmn1r52 T A 6: 90,179,257 M181K possibly damaging Het
Zbtb48 A T 4: 152,022,110 C345S probably damaging Het
Zfp628 G A 7: 4,918,959 R60Q probably damaging Het
Zfp638 T C 6: 83,929,731 S293P possibly damaging Het
Zkscan17 G A 11: 59,502,944 P183S probably benign Het
Zscan12 G T 13: 21,363,727 K26N probably benign Het
Other mutations in Olfr12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Olfr12 APN 1 92620199 missense possibly damaging 0.88
IGL01309:Olfr12 APN 1 92620335 missense probably damaging 1.00
IGL02025:Olfr12 APN 1 92620547 missense probably benign 0.00
IGL02517:Olfr12 APN 1 92620461 missense probably benign
IGL02837:Olfr12 UTSW 1 92620682 missense possibly damaging 0.73
R1394:Olfr12 UTSW 1 92620545 missense probably benign 0.02
R1395:Olfr12 UTSW 1 92620545 missense probably benign 0.02
R1590:Olfr12 UTSW 1 92620745 missense possibly damaging 0.64
R1778:Olfr12 UTSW 1 92620620 missense possibly damaging 0.94
R1924:Olfr12 UTSW 1 92620803 missense probably damaging 1.00
R2011:Olfr12 UTSW 1 92620749 missense probably benign 0.01
R3877:Olfr12 UTSW 1 92620083 missense probably damaging 1.00
R5286:Olfr12 UTSW 1 92620362 missense probably benign 0.38
R5513:Olfr12 UTSW 1 92620380 missense probably benign
R5727:Olfr12 UTSW 1 92620178 missense probably benign 0.00
R5905:Olfr12 UTSW 1 92620142 missense possibly damaging 0.49
R5921:Olfr12 UTSW 1 92620622 missense probably benign 0.01
R7614:Olfr12 UTSW 1 92620461 missense probably damaging 0.99
R7959:Olfr12 UTSW 1 92620307 missense probably damaging 0.96
R8073:Olfr12 UTSW 1 92620084 missense probably damaging 1.00
R8680:Olfr12 UTSW 1 92619921 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AATGCCCTGGCCAACTTTC -3'
(R):5'- ACAGCTAAGGTGGTGCTCAC -3'

Sequencing Primer
(F):5'- TCTCTCCACCTCCAAAGTCATCAG -3'
(R):5'- GTGGTGCTCACAATGATGAACCC -3'
Posted On2020-07-13