Mutagenetix > Incidental Mutation

Incidental Mutation 'R8161:Rapgef1'

633495

Institutional Source

Beutler Lab

Gene Symbol

Rapgef1

Ensembl Gene

ENSMUSG00000039844

Gene Name

Rap guanine nucleotide exchange factor (GEF) 1

Synonyms

Grf2, 4932418O06Rik, C3G

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8161 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

29619720-29740978 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 29679198 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 43 (I43L)

Ref Sequence

ENSEMBL: ENSMUSP00000092703 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091146] [ENSMUST00000095087] [ENSMUST00000102872] [ENSMUST00000147755]

AlphaFold

Q3UHC1

Predicted Effect

probably damaging
Transcript: ENSMUST00000091146
AA Change: I43L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000088680
Gene: ENSMUSG00000039844
AA Change: I43L

Domain	Start	End	E-Value	Type
low complexity region	191	206	N/A	INTRINSIC
low complexity region	309	324	N/A	INTRINSIC
low complexity region	468	478	N/A	INTRINSIC
low complexity region	510	521	N/A	INTRINSIC
low complexity region	592	603	N/A	INTRINSIC
low complexity region	664	682	N/A	INTRINSIC
low complexity region	689	700	N/A	INTRINSIC
low complexity region	727	741	N/A	INTRINSIC
RasGEFN	828	970	8.04e-37	SMART
RasGEF	977	1206	5.85e-102	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000095087
AA Change: I43L

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000092703
Gene: ENSMUSG00000039844
AA Change: I43L

Domain	Start	End	E-Value	Type
low complexity region	229	244	N/A	INTRINSIC
low complexity region	347	362	N/A	INTRINSIC
low complexity region	506	516	N/A	INTRINSIC
low complexity region	548	559	N/A	INTRINSIC
low complexity region	630	641	N/A	INTRINSIC
low complexity region	702	720	N/A	INTRINSIC
low complexity region	727	738	N/A	INTRINSIC
RasGEFN	834	976	8.04e-37	SMART
RasGEF	983	1212	5.85e-102	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000102872
AA Change: I43L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000099936
Gene: ENSMUSG00000039844
AA Change: I43L

Domain	Start	End	E-Value	Type
low complexity region	229	244	N/A	INTRINSIC
low complexity region	347	362	N/A	INTRINSIC
low complexity region	506	516	N/A	INTRINSIC
low complexity region	548	559	N/A	INTRINSIC
RasGEFN	696	838	8.04e-37	SMART
RasGEF	845	1074	5.85e-102	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000147755
AA Change: I43L

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000121615
Gene: ENSMUSG00000039844
AA Change: I43L

Domain	Start	End	E-Value	Type
low complexity region	191	206	N/A	INTRINSIC
low complexity region	309	324	N/A	INTRINSIC
low complexity region	468	478	N/A	INTRINSIC
low complexity region	510	521	N/A	INTRINSIC
low complexity region	591	602	N/A	INTRINSIC
low complexity region	663	681	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.3%
20x: 97.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a human guanine nucleotide exchange factor. It transduces signals from CRK by binding the SH3 domain of CRK, and activating several members of the Ras family of GTPases. This signaling cascade that may be involved in apoptosis, integrin-mediated signal transduction, and cell transformation. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele die before E7.5. Mice homozygous for a hypomorphic gene trap allele show embryonic lethality during organogenesis, altered neuroepithelium morphology, vascular maturation defects, hemorrhage, and reduced cell migration and adhesion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9630041A04Rik	T	C	9: 101,938,769	L51P	probably damaging	Het
Adgrb3	A	T	1: 25,093,922	M1121K	probably benign	Het
Ank2	T	C	3: 127,032,129	N371S		Het
Arhgef5	T	A	6: 43,283,951	C1437S	probably damaging	Het
Atp8b1	A	T	18: 64,556,987	L558Q	probably damaging	Het
Bsn	T	C	9: 108,139,530	K94R	probably benign	Het
Cacna2d1	T	A	5: 16,314,937	V435D	probably damaging	Het
Chd3	T	C	11: 69,350,885	N1474S	probably damaging	Het
Chd7	A	G	4: 8,855,038	D2089G	probably damaging	Het
Col11a2	T	A	17: 34,051,290	M492K	unknown	Het
Col16a1	A	T	4: 130,060,469	T502S	unknown	Het
Csl	A	T	10: 99,758,320	N294K	probably damaging	Het
Dnah5	T	A	15: 28,350,704	M2624K	possibly damaging	Het
Dync1li1	C	A	9: 114,706,183	H172N	probably damaging	Het
Eef1a1	C	T	9: 78,480,390	V59I	probably benign	Het
Ephb1	T	C	9: 102,194,813	K256E	probably damaging	Het
Erlin2	C	A	8: 27,028,942	T78N	probably damaging	Het
Fbxo10	A	G	4: 45,044,793	L614P	probably damaging	Het
Fer1l4	A	T	2: 156,024,635	D1555E	probably benign	Het
Gabrr2	A	G	4: 33,082,566	D230G	probably damaging	Het
Gen1	A	T	12: 11,241,464	S840T	probably benign	Het
Glyctk	G	A	9: 106,157,693	T58I	probably benign	Het
Gm10471	T	C	5: 26,084,692	S246G	possibly damaging	Het
Gm12258	G	A	11: 58,859,312	A438T	unknown	Het
Gm14305	A	G	2: 176,721,505	T397A	probably benign	Het
Hnrnpu	G	T	1: 178,337,502	R24S	possibly damaging	Het
Iffo2	A	G	4: 139,574,954	N3D	possibly damaging	Het
Insr	C	T	8: 3,258,660	M125I	probably damaging	Het
Itsn1	G	A	16: 91,818,558	R397H	unknown	Het
Kcnj16	T	A	11: 111,024,515	M1K	probably null	Het
Kcns3	G	A	12: 11,119,763		probably benign	Het
Kmt2c	A	G	5: 25,374,564	V578A	probably benign	Het
Krt79	T	C	15: 101,930,702	K444R	probably damaging	Het
Mtg2	T	C	2: 180,085,575	V340A	probably benign	Het
Mtr	A	C	13: 12,221,486	L618R	probably damaging	Het
Myo6	T	A	9: 80,217,709	D23E	unknown	Het
Nos1ap	A	G	1: 170,390,759	V27A	probably damaging	Het
Npc1	A	T	18: 12,195,072	I1060K	possibly damaging	Het
Nrbp1	T	A	5: 31,243,849	L23*	probably null	Het
Olfr1113	T	C	2: 87,213,804	I304T	probably damaging	Het
Olfr12	G	A	1: 92,620,356	R150H	probably benign	Het
Olfr147	C	A	9: 38,403,507	T211K	probably damaging	Het
Olfr406	A	T	11: 74,269,718	M110L	probably benign	Het
Olfr804	A	T	10: 129,704,884	K2I	possibly damaging	Het
Pcdhgc5	A	T	18: 37,821,562	T630S	probably damaging	Het
Pgm1	C	A	5: 64,112,160	T530K	probably damaging	Het
Phf20l1	A	T	15: 66,604,073	N185I	probably damaging	Het
Pkp2	A	G	16: 16,213,449	D26G	probably damaging	Het
Rangap1	C	T	15: 81,710,495	E378K	probably benign	Het
Rbfox1	A	G	16: 7,277,028	T111A		Het
Rptn	GCAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCA	GCAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCA	3: 93,396,693		probably benign	Het
Spata16	A	T	3: 26,840,662	M287L	probably benign	Het
Stau2	A	G	1: 16,345,825	M470T	probably benign	Het
Tcf12	T	C	9: 72,015,651	Y70C	probably damaging	Het
Tsc22d1	C	T	14: 76,417,020	T313M	probably benign	Het
Vmn1r52	T	A	6: 90,179,257	M181K	possibly damaging	Het
Zbtb48	A	T	4: 152,022,110	C345S	probably damaging	Het
Zfp628	G	A	7: 4,918,959	R60Q	probably damaging	Het
Zfp638	T	C	6: 83,929,731	S293P	possibly damaging	Het
Zkscan17	G	A	11: 59,502,944	P183S	probably benign	Het
Zscan12	G	T	13: 21,363,727	K26N	probably benign	Het

Other mutations in Rapgef1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Rapgef1	APN	2	29722269	missense	probably benign
IGL00917:Rapgef1	APN	2	29702523	missense	probably benign	0.00
IGL02618:Rapgef1	APN	2	29737943	missense	probably damaging	1.00
IGL02642:Rapgef1	APN	2	29700860	splice site	probably benign
IGL02974:Rapgef1	APN	2	29710216	missense	possibly damaging	0.64
R0034:Rapgef1	UTSW	2	29724768	splice site	probably benign
R0034:Rapgef1	UTSW	2	29724768	splice site	probably benign
R0241:Rapgef1	UTSW	2	29702670	missense	possibly damaging	0.53
R0241:Rapgef1	UTSW	2	29702670	missense	possibly damaging	0.53
R0279:Rapgef1	UTSW	2	29726227	missense	probably damaging	1.00
R0432:Rapgef1	UTSW	2	29679816	missense	possibly damaging	0.86
R1817:Rapgef1	UTSW	2	29686256	missense	probably damaging	1.00
R1837:Rapgef1	UTSW	2	29737426	missense	probably damaging	1.00
R1970:Rapgef1	UTSW	2	29733711	missense	probably damaging	1.00
R1980:Rapgef1	UTSW	2	29722227	missense	probably benign
R2076:Rapgef1	UTSW	2	29702508	missense	probably benign	0.00
R2363:Rapgef1	UTSW	2	29736596	missense	possibly damaging	0.63
R3016:Rapgef1	UTSW	2	29707393	missense	probably damaging	1.00
R3053:Rapgef1	UTSW	2	29724856	missense	probably damaging	1.00
R3777:Rapgef1	UTSW	2	29719689	missense	possibly damaging	0.67
R3980:Rapgef1	UTSW	2	29719650	missense	probably benign	0.33
R4491:Rapgef1	UTSW	2	29719656	missense	possibly damaging	0.93
R4524:Rapgef1	UTSW	2	29679246	missense	probably benign	0.00
R4732:Rapgef1	UTSW	2	29689160	missense	probably damaging	1.00
R4733:Rapgef1	UTSW	2	29689160	missense	probably damaging	1.00
R5391:Rapgef1	UTSW	2	29737965	missense	probably damaging	1.00
R5395:Rapgef1	UTSW	2	29737965	missense	probably damaging	1.00
R5611:Rapgef1	UTSW	2	29702436	missense	probably damaging	0.96
R6062:Rapgef1	UTSW	2	29700732	missense	probably damaging	0.96
R6145:Rapgef1	UTSW	2	29736666	missense	probably damaging	1.00
R6580:Rapgef1	UTSW	2	29730609	missense	possibly damaging	0.95
R6892:Rapgef1	UTSW	2	29699840	critical splice donor site	probably null
R6897:Rapgef1	UTSW	2	29702502	missense	probably damaging	1.00
R6957:Rapgef1	UTSW	2	29733698	missense	possibly damaging	0.62
R7039:Rapgef1	UTSW	2	29726214	missense	probably damaging	0.97
R7149:Rapgef1	UTSW	2	29720700	missense	probably damaging	0.98
R7253:Rapgef1	UTSW	2	29699721	missense	possibly damaging	0.72
R7315:Rapgef1	UTSW	2	29734492	missense	probably damaging	0.98
R7956:Rapgef1	UTSW	2	29699015	missense	probably benign	0.03
R8162:Rapgef1	UTSW	2	29735999	missense	probably damaging	0.99
R8372:Rapgef1	UTSW	2	29710231	missense	probably damaging	0.99
R8373:Rapgef1	UTSW	2	29710231	missense	probably damaging	0.99
R8485:Rapgef1	UTSW	2	29710174	missense	probably damaging	1.00
R8838:Rapgef1	UTSW	2	29737446	missense	possibly damaging	0.77
R9484:Rapgef1	UTSW	2	29735809	missense	possibly damaging	0.95
R9521:Rapgef1	UTSW	2	29734279	missense	probably benign	0.16
RF005:Rapgef1	UTSW	2	29707195	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- GAACAGGTCCATATGTCCCTTCC -3'
(R):5'- AAACTGTCCAAGCCACTGG -3'

Sequencing Primer
(F):5'- CCTTTAACTCTTTCAAGGAGGAAG -3'
(R):5'- TGATTAGCAGTCCTAGAGGTCCCAG -3'

Posted On

2020-07-13