Incidental Mutation 'R8161:Rapgef1'
ID633495
Institutional Source Beutler Lab
Gene Symbol Rapgef1
Ensembl Gene ENSMUSG00000039844
Gene NameRap guanine nucleotide exchange factor (GEF) 1
SynonymsGrf2, 4932418O06Rik, C3G
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8161 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location29619720-29740978 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 29679198 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 43 (I43L)
Ref Sequence ENSEMBL: ENSMUSP00000092703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091146] [ENSMUST00000095087] [ENSMUST00000102872] [ENSMUST00000147755]
Predicted Effect probably damaging
Transcript: ENSMUST00000091146
AA Change: I43L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000088680
Gene: ENSMUSG00000039844
AA Change: I43L

DomainStartEndE-ValueType
low complexity region 191 206 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
low complexity region 468 478 N/A INTRINSIC
low complexity region 510 521 N/A INTRINSIC
low complexity region 592 603 N/A INTRINSIC
low complexity region 664 682 N/A INTRINSIC
low complexity region 689 700 N/A INTRINSIC
low complexity region 727 741 N/A INTRINSIC
RasGEFN 828 970 8.04e-37 SMART
RasGEF 977 1206 5.85e-102 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095087
AA Change: I43L

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000092703
Gene: ENSMUSG00000039844
AA Change: I43L

DomainStartEndE-ValueType
low complexity region 229 244 N/A INTRINSIC
low complexity region 347 362 N/A INTRINSIC
low complexity region 506 516 N/A INTRINSIC
low complexity region 548 559 N/A INTRINSIC
low complexity region 630 641 N/A INTRINSIC
low complexity region 702 720 N/A INTRINSIC
low complexity region 727 738 N/A INTRINSIC
RasGEFN 834 976 8.04e-37 SMART
RasGEF 983 1212 5.85e-102 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102872
AA Change: I43L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099936
Gene: ENSMUSG00000039844
AA Change: I43L

DomainStartEndE-ValueType
low complexity region 229 244 N/A INTRINSIC
low complexity region 347 362 N/A INTRINSIC
low complexity region 506 516 N/A INTRINSIC
low complexity region 548 559 N/A INTRINSIC
RasGEFN 696 838 8.04e-37 SMART
RasGEF 845 1074 5.85e-102 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147755
AA Change: I43L

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000121615
Gene: ENSMUSG00000039844
AA Change: I43L

DomainStartEndE-ValueType
low complexity region 191 206 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
low complexity region 468 478 N/A INTRINSIC
low complexity region 510 521 N/A INTRINSIC
low complexity region 591 602 N/A INTRINSIC
low complexity region 663 681 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a human guanine nucleotide exchange factor. It transduces signals from CRK by binding the SH3 domain of CRK, and activating several members of the Ras family of GTPases. This signaling cascade that may be involved in apoptosis, integrin-mediated signal transduction, and cell transformation. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele die before E7.5. Mice homozygous for a hypomorphic gene trap allele show embryonic lethality during organogenesis, altered neuroepithelium morphology, vascular maturation defects, hemorrhage, and reduced cell migration and adhesion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik T C 9: 101,938,769 L51P probably damaging Het
Adgrb3 A T 1: 25,093,922 M1121K probably benign Het
Ank2 T C 3: 127,032,129 N371S Het
Arhgef5 T A 6: 43,283,951 C1437S probably damaging Het
Atp8b1 A T 18: 64,556,987 L558Q probably damaging Het
Bsn T C 9: 108,139,530 K94R probably benign Het
Cacna2d1 T A 5: 16,314,937 V435D probably damaging Het
Chd3 T C 11: 69,350,885 N1474S probably damaging Het
Chd7 A G 4: 8,855,038 D2089G probably damaging Het
Col11a2 T A 17: 34,051,290 M492K unknown Het
Col16a1 A T 4: 130,060,469 T502S unknown Het
Csl A T 10: 99,758,320 N294K probably damaging Het
Dnah5 T A 15: 28,350,704 M2624K possibly damaging Het
Dync1li1 C A 9: 114,706,183 H172N probably damaging Het
Eef1a1 C T 9: 78,480,390 V59I probably benign Het
Ephb1 T C 9: 102,194,813 K256E probably damaging Het
Erlin2 C A 8: 27,028,942 T78N probably damaging Het
Fbxo10 A G 4: 45,044,793 L614P probably damaging Het
Fer1l4 A T 2: 156,024,635 D1555E probably benign Het
Gabrr2 A G 4: 33,082,566 D230G probably damaging Het
Gen1 A T 12: 11,241,464 S840T probably benign Het
Glyctk G A 9: 106,157,693 T58I probably benign Het
Gm10471 T C 5: 26,084,692 S246G possibly damaging Het
Gm12258 G A 11: 58,859,312 A438T unknown Het
Gm14305 A G 2: 176,721,505 T397A probably benign Het
Hnrnpu G T 1: 178,337,502 R24S possibly damaging Het
Iffo2 A G 4: 139,574,954 N3D possibly damaging Het
Insr C T 8: 3,258,660 M125I probably damaging Het
Itsn1 G A 16: 91,818,558 R397H unknown Het
Kcnj16 T A 11: 111,024,515 M1K probably null Het
Kcns3 G A 12: 11,119,763 probably benign Het
Kmt2c A G 5: 25,374,564 V578A probably benign Het
Krt79 T C 15: 101,930,702 K444R probably damaging Het
Mtg2 T C 2: 180,085,575 V340A probably benign Het
Mtr A C 13: 12,221,486 L618R probably damaging Het
Myo6 T A 9: 80,217,709 D23E unknown Het
Nos1ap A G 1: 170,390,759 V27A probably damaging Het
Npc1 A T 18: 12,195,072 I1060K possibly damaging Het
Nrbp1 T A 5: 31,243,849 L23* probably null Het
Olfr1113 T C 2: 87,213,804 I304T probably damaging Het
Olfr12 G A 1: 92,620,356 R150H probably benign Het
Olfr147 C A 9: 38,403,507 T211K probably damaging Het
Olfr406 A T 11: 74,269,718 M110L probably benign Het
Olfr804 A T 10: 129,704,884 K2I possibly damaging Het
Pcdhgc5 A T 18: 37,821,562 T630S probably damaging Het
Pgm1 C A 5: 64,112,160 T530K probably damaging Het
Phf20l1 A T 15: 66,604,073 N185I probably damaging Het
Pkp2 A G 16: 16,213,449 D26G probably damaging Het
Rangap1 C T 15: 81,710,495 E378K probably benign Het
Rbfox1 A G 16: 7,277,028 T111A Het
Rptn GCAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCA GCAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCA 3: 93,396,693 probably benign Het
Spata16 A T 3: 26,840,662 M287L probably benign Het
Stau2 A G 1: 16,345,825 M470T probably benign Het
Tcf12 T C 9: 72,015,651 Y70C probably damaging Het
Tsc22d1 C T 14: 76,417,020 T313M probably benign Het
Vmn1r52 T A 6: 90,179,257 M181K possibly damaging Het
Zbtb48 A T 4: 152,022,110 C345S probably damaging Het
Zfp628 G A 7: 4,918,959 R60Q probably damaging Het
Zfp638 T C 6: 83,929,731 S293P possibly damaging Het
Zkscan17 G A 11: 59,502,944 P183S probably benign Het
Zscan12 G T 13: 21,363,727 K26N probably benign Het
Other mutations in Rapgef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Rapgef1 APN 2 29722269 missense probably benign
IGL00917:Rapgef1 APN 2 29702523 missense probably benign 0.00
IGL02618:Rapgef1 APN 2 29737943 missense probably damaging 1.00
IGL02642:Rapgef1 APN 2 29700860 splice site probably benign
IGL02974:Rapgef1 APN 2 29710216 missense possibly damaging 0.64
R0034:Rapgef1 UTSW 2 29724768 splice site probably benign
R0034:Rapgef1 UTSW 2 29724768 splice site probably benign
R0241:Rapgef1 UTSW 2 29702670 missense possibly damaging 0.53
R0241:Rapgef1 UTSW 2 29702670 missense possibly damaging 0.53
R0279:Rapgef1 UTSW 2 29726227 missense probably damaging 1.00
R0432:Rapgef1 UTSW 2 29679816 missense possibly damaging 0.86
R1817:Rapgef1 UTSW 2 29686256 missense probably damaging 1.00
R1837:Rapgef1 UTSW 2 29737426 missense probably damaging 1.00
R1970:Rapgef1 UTSW 2 29733711 missense probably damaging 1.00
R1980:Rapgef1 UTSW 2 29722227 missense probably benign
R2076:Rapgef1 UTSW 2 29702508 missense probably benign 0.00
R2363:Rapgef1 UTSW 2 29736596 missense possibly damaging 0.63
R3016:Rapgef1 UTSW 2 29707393 missense probably damaging 1.00
R3053:Rapgef1 UTSW 2 29724856 missense probably damaging 1.00
R3777:Rapgef1 UTSW 2 29719689 missense possibly damaging 0.67
R3980:Rapgef1 UTSW 2 29719650 missense probably benign 0.33
R4491:Rapgef1 UTSW 2 29719656 missense possibly damaging 0.93
R4524:Rapgef1 UTSW 2 29679246 missense probably benign 0.00
R4732:Rapgef1 UTSW 2 29689160 missense probably damaging 1.00
R4733:Rapgef1 UTSW 2 29689160 missense probably damaging 1.00
R5391:Rapgef1 UTSW 2 29737965 missense probably damaging 1.00
R5395:Rapgef1 UTSW 2 29737965 missense probably damaging 1.00
R5611:Rapgef1 UTSW 2 29702436 missense probably damaging 0.96
R6062:Rapgef1 UTSW 2 29700732 missense probably damaging 0.96
R6145:Rapgef1 UTSW 2 29736666 missense probably damaging 1.00
R6580:Rapgef1 UTSW 2 29730609 missense possibly damaging 0.95
R6892:Rapgef1 UTSW 2 29699840 critical splice donor site probably null
R6897:Rapgef1 UTSW 2 29702502 missense probably damaging 1.00
R6957:Rapgef1 UTSW 2 29733698 missense possibly damaging 0.62
R7039:Rapgef1 UTSW 2 29726214 missense probably damaging 0.97
R7149:Rapgef1 UTSW 2 29720700 missense probably damaging 0.98
R7253:Rapgef1 UTSW 2 29699721 missense possibly damaging 0.72
R7315:Rapgef1 UTSW 2 29734492 missense probably damaging 0.98
R7956:Rapgef1 UTSW 2 29699015 missense probably benign 0.03
R8162:Rapgef1 UTSW 2 29735999 missense probably damaging 0.99
R8372:Rapgef1 UTSW 2 29710231 missense probably damaging 0.99
R8373:Rapgef1 UTSW 2 29710231 missense probably damaging 0.99
RF005:Rapgef1 UTSW 2 29707195 splice site probably null
Predicted Primers PCR Primer
(F):5'- GAACAGGTCCATATGTCCCTTCC -3'
(R):5'- AAACTGTCCAAGCCACTGG -3'

Sequencing Primer
(F):5'- CCTTTAACTCTTTCAAGGAGGAAG -3'
(R):5'- TGATTAGCAGTCCTAGAGGTCCCAG -3'
Posted On2020-07-13