Mutagenetix > Incidental Mutation

Incidental Mutation 'R8161:Arhgef5'

633514

Institutional Source

Beutler Lab

Gene Symbol

Arhgef5

Ensembl Gene

ENSMUSG00000033542

Gene Name

Rho guanine nucleotide exchange factor (GEF) 5

Synonyms

2210412D05Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8161 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

43265582-43289320 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 43283951 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 1437 (C1437S)

Ref Sequence

ENSEMBL: ENSMUSP00000031750 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031750]

AlphaFold

E9Q7D5

Predicted Effect

probably damaging
Transcript: ENSMUST00000031750
AA Change: C1437S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: C1437S

Domain	Start	End	E-Value	Type
Pfam:ARHGEF5_35	1	477	3.1e-220	PFAM
low complexity region	509	531	N/A	INTRINSIC
low complexity region	812	825	N/A	INTRINSIC
low complexity region	827	851	N/A	INTRINSIC
RhoGEF	1162	1341	2.97e-57	SMART
PH	1375	1488	1.11e-6	SMART
SH3	1497	1554	6.39e-15	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000182924

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.3%
20x: 97.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9630041A04Rik	T	C	9: 101,938,769	L51P	probably damaging	Het
Adgrb3	A	T	1: 25,093,922	M1121K	probably benign	Het
Ank2	T	C	3: 127,032,129	N371S		Het
Atp8b1	A	T	18: 64,556,987	L558Q	probably damaging	Het
Bsn	T	C	9: 108,139,530	K94R	probably benign	Het
Cacna2d1	T	A	5: 16,314,937	V435D	probably damaging	Het
Chd3	T	C	11: 69,350,885	N1474S	probably damaging	Het
Chd7	A	G	4: 8,855,038	D2089G	probably damaging	Het
Col11a2	T	A	17: 34,051,290	M492K	unknown	Het
Col16a1	A	T	4: 130,060,469	T502S	unknown	Het
Csl	A	T	10: 99,758,320	N294K	probably damaging	Het
Dnah5	T	A	15: 28,350,704	M2624K	possibly damaging	Het
Dync1li1	C	A	9: 114,706,183	H172N	probably damaging	Het
Eef1a1	C	T	9: 78,480,390	V59I	probably benign	Het
Ephb1	T	C	9: 102,194,813	K256E	probably damaging	Het
Erlin2	C	A	8: 27,028,942	T78N	probably damaging	Het
Fbxo10	A	G	4: 45,044,793	L614P	probably damaging	Het
Fer1l4	A	T	2: 156,024,635	D1555E	probably benign	Het
Gabrr2	A	G	4: 33,082,566	D230G	probably damaging	Het
Gen1	A	T	12: 11,241,464	S840T	probably benign	Het
Glyctk	G	A	9: 106,157,693	T58I	probably benign	Het
Gm10471	T	C	5: 26,084,692	S246G	possibly damaging	Het
Gm12258	G	A	11: 58,859,312	A438T	unknown	Het
Gm14305	A	G	2: 176,721,505	T397A	probably benign	Het
Hnrnpu	G	T	1: 178,337,502	R24S	possibly damaging	Het
Iffo2	A	G	4: 139,574,954	N3D	possibly damaging	Het
Insr	C	T	8: 3,258,660	M125I	probably damaging	Het
Itsn1	G	A	16: 91,818,558	R397H	unknown	Het
Kcnj16	T	A	11: 111,024,515	M1K	probably null	Het
Kcns3	G	A	12: 11,119,763		probably benign	Het
Kmt2c	A	G	5: 25,374,564	V578A	probably benign	Het
Krt79	T	C	15: 101,930,702	K444R	probably damaging	Het
Mtg2	T	C	2: 180,085,575	V340A	probably benign	Het
Mtr	A	C	13: 12,221,486	L618R	probably damaging	Het
Myo6	T	A	9: 80,217,709	D23E	unknown	Het
Nos1ap	A	G	1: 170,390,759	V27A	probably damaging	Het
Npc1	A	T	18: 12,195,072	I1060K	possibly damaging	Het
Nrbp1	T	A	5: 31,243,849	L23*	probably null	Het
Olfr1113	T	C	2: 87,213,804	I304T	probably damaging	Het
Olfr12	G	A	1: 92,620,356	R150H	probably benign	Het
Olfr147	C	A	9: 38,403,507	T211K	probably damaging	Het
Olfr406	A	T	11: 74,269,718	M110L	probably benign	Het
Olfr804	A	T	10: 129,704,884	K2I	possibly damaging	Het
Pcdhgc5	A	T	18: 37,821,562	T630S	probably damaging	Het
Pgm1	C	A	5: 64,112,160	T530K	probably damaging	Het
Phf20l1	A	T	15: 66,604,073	N185I	probably damaging	Het
Pkp2	A	G	16: 16,213,449	D26G	probably damaging	Het
Rangap1	C	T	15: 81,710,495	E378K	probably benign	Het
Rapgef1	A	C	2: 29,679,198	I43L	probably benign	Het
Rbfox1	A	G	16: 7,277,028	T111A		Het
Rptn	GCAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCA	GCAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCA	3: 93,396,693		probably benign	Het
Spata16	A	T	3: 26,840,662	M287L	probably benign	Het
Stau2	A	G	1: 16,345,825	M470T	probably benign	Het
Tcf12	T	C	9: 72,015,651	Y70C	probably damaging	Het
Tsc22d1	C	T	14: 76,417,020	T313M	probably benign	Het
Vmn1r52	T	A	6: 90,179,257	M181K	possibly damaging	Het
Zbtb48	A	T	4: 152,022,110	C345S	probably damaging	Het
Zfp628	G	A	7: 4,918,959	R60Q	probably damaging	Het
Zfp638	T	C	6: 83,929,731	S293P	possibly damaging	Het
Zkscan17	G	A	11: 59,502,944	P183S	probably benign	Het
Zscan12	G	T	13: 21,363,727	K26N	probably benign	Het

Other mutations in Arhgef5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Arhgef5	APN	6	43280269	nonsense	probably null
IGL01341:Arhgef5	APN	6	43283991	missense	probably damaging	1.00
IGL01576:Arhgef5	APN	6	43274028	missense	probably benign	0.38
IGL01761:Arhgef5	APN	6	43274604	missense	probably benign	0.00
IGL02104:Arhgef5	APN	6	43272411	missense	probably damaging	0.99
IGL02208:Arhgef5	APN	6	43275130	missense	probably benign	0.11
IGL02487:Arhgef5	APN	6	43283982	missense	probably damaging	1.00
IGL02650:Arhgef5	APN	6	43272935	nonsense	probably null
IGL03292:Arhgef5	APN	6	43280246	missense	probably damaging	1.00
IGL03334:Arhgef5	APN	6	43274000	missense	possibly damaging	0.47
IGL03341:Arhgef5	APN	6	43280651	missense	probably damaging	0.99
R0047:Arhgef5	UTSW	6	43265621	splice site	probably null
R0206:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0208:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0698:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1168:Arhgef5	UTSW	6	43273396	missense	probably benign	0.00
R1355:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1370:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1481:Arhgef5	UTSW	6	43274634	missense	probably damaging	0.99
R1529:Arhgef5	UTSW	6	43279515	missense	probably damaging	0.96
R1532:Arhgef5	UTSW	6	43273403	missense	probably benign
R1663:Arhgef5	UTSW	6	43276965	missense	probably damaging	1.00
R1742:Arhgef5	UTSW	6	43280199	missense	probably damaging	1.00
R1852:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R1869:Arhgef5	UTSW	6	43288682	missense	probably damaging	1.00
R1880:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R2146:Arhgef5	UTSW	6	43283318	missense	probably damaging	1.00
R2169:Arhgef5	UTSW	6	43274420	missense	probably benign	0.11
R3412:Arhgef5	UTSW	6	43273790	missense	probably benign
R4205:Arhgef5	UTSW	6	43273832	missense	possibly damaging	0.76
R4226:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4227:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4304:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4308:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4457:Arhgef5	UTSW	6	43274093	missense	probably damaging	1.00
R4469:Arhgef5	UTSW	6	43275099	missense	probably benign
R4636:Arhgef5	UTSW	6	43274942	missense	probably benign	0.11
R4791:Arhgef5	UTSW	6	43283183	missense	probably damaging	1.00
R4818:Arhgef5	UTSW	6	43273550	missense	probably benign	0.00
R4910:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R4911:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R5127:Arhgef5	UTSW	6	43273214	missense	probably damaging	0.99
R5209:Arhgef5	UTSW	6	43273700	missense	probably benign	0.01
R5245:Arhgef5	UTSW	6	43265680	start gained	probably benign
R5251:Arhgef5	UTSW	6	43272881	missense	possibly damaging	0.76
R5513:Arhgef5	UTSW	6	43272339	missense	probably damaging	0.96
R5613:Arhgef5	UTSW	6	43274063	missense	probably benign	0.01
R5616:Arhgef5	UTSW	6	43275940	missense	probably benign	0.20
R5817:Arhgef5	UTSW	6	43275104	missense	probably benign	0.15
R6024:Arhgef5	UTSW	6	43275134	missense	probably benign	0.00
R6735:Arhgef5	UTSW	6	43275032	missense	probably benign	0.01
R6825:Arhgef5	UTSW	6	43274961	missense	probably damaging	0.99
R6831:Arhgef5	UTSW	6	43280999	missense	probably damaging	1.00
R6901:Arhgef5	UTSW	6	43273298	missense	probably benign	0.00
R6932:Arhgef5	UTSW	6	43274417	missense	possibly damaging	0.94
R6968:Arhgef5	UTSW	6	43275342	missense	probably benign	0.00
R7018:Arhgef5	UTSW	6	43288731	missense	probably damaging	1.00
R7180:Arhgef5	UTSW	6	43275208	missense	possibly damaging	0.87
R7201:Arhgef5	UTSW	6	43273232	nonsense	probably null
R7358:Arhgef5	UTSW	6	43279573	missense	probably damaging	1.00
R7359:Arhgef5	UTSW	6	43280282	missense	probably damaging	1.00
R7468:Arhgef5	UTSW	6	43280671	nonsense	probably null
R7503:Arhgef5	UTSW	6	43273999	missense	probably benign	0.15
R7699:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7700:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7737:Arhgef5	UTSW	6	43273794	missense	possibly damaging	0.84
R7847:Arhgef5	UTSW	6	43275135	nonsense	probably null
R7950:Arhgef5	UTSW	6	43273925	missense	possibly damaging	0.76
R8178:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R8203:Arhgef5	UTSW	6	43280645	missense	probably damaging	1.00
R8318:Arhgef5	UTSW	6	43275999	critical splice donor site	probably null
R8857:Arhgef5	UTSW	6	43287624	missense	probably damaging	1.00
R9499:Arhgef5	UTSW	6	43284006	missense
R9610:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9611:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9623:Arhgef5	UTSW	6	43274802	missense	possibly damaging	0.86
R9685:Arhgef5	UTSW	6	43273593	missense	probably benign	0.11
RF023:Arhgef5	UTSW	6	43279473	missense	probably damaging	1.00
X0028:Arhgef5	UTSW	6	43273701	missense	probably benign	0.03
X0065:Arhgef5	UTSW	6	43272408	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CAGAGTAAGTTGAAGCCCTCATATG -3'
(R):5'- AGAAGTGCTGAGTCATGGTC -3'

Sequencing Primer
(F):5'- GCCCTCATATGGCTTTTATATGATAC -3'
(R):5'- CATGGTCTGCATATGGTTCTGACC -3'

Posted On

2020-07-13