Incidental Mutation 'R8161:Arhgef5'
ID 633514
Institutional Source Beutler Lab
Gene Symbol Arhgef5
Ensembl Gene ENSMUSG00000033542
Gene Name Rho guanine nucleotide exchange factor 5
Synonyms 2210412D05Rik
MMRRC Submission 067587-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8161 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 43242578-43266254 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 43260885 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 1437 (C1437S)
Ref Sequence ENSEMBL: ENSMUSP00000031750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031750]
AlphaFold E9Q7D5
Predicted Effect probably damaging
Transcript: ENSMUST00000031750
AA Change: C1437S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: C1437S

DomainStartEndE-ValueType
Pfam:ARHGEF5_35 1 477 3.1e-220 PFAM
low complexity region 509 531 N/A INTRINSIC
low complexity region 812 825 N/A INTRINSIC
low complexity region 827 851 N/A INTRINSIC
RhoGEF 1162 1341 2.97e-57 SMART
PH 1375 1488 1.11e-6 SMART
SH3 1497 1554 6.39e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182924
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik T C 9: 101,815,968 (GRCm39) L51P probably damaging Het
Adgrb3 A T 1: 25,133,003 (GRCm39) M1121K probably benign Het
Ank2 T C 3: 126,825,778 (GRCm39) N371S Het
Atp8b1 A T 18: 64,690,058 (GRCm39) L558Q probably damaging Het
Bsn T C 9: 108,016,729 (GRCm39) K94R probably benign Het
Cacna2d1 T A 5: 16,519,935 (GRCm39) V435D probably damaging Het
Chd3 T C 11: 69,241,711 (GRCm39) N1474S probably damaging Het
Chd7 A G 4: 8,855,038 (GRCm39) D2089G probably damaging Het
Col11a2 T A 17: 34,270,264 (GRCm39) M492K unknown Het
Col16a1 A T 4: 129,954,262 (GRCm39) T502S unknown Het
Csl A T 10: 99,594,182 (GRCm39) N294K probably damaging Het
Dnah5 T A 15: 28,350,850 (GRCm39) M2624K possibly damaging Het
Dync1li1 C A 9: 114,535,251 (GRCm39) H172N probably damaging Het
Eef1a1 C T 9: 78,387,672 (GRCm39) V59I probably benign Het
Ephb1 T C 9: 102,072,012 (GRCm39) K256E probably damaging Het
Erlin2 C A 8: 27,518,970 (GRCm39) T78N probably damaging Het
Fbxo10 A G 4: 45,044,793 (GRCm39) L614P probably damaging Het
Fer1l4 A T 2: 155,866,555 (GRCm39) D1555E probably benign Het
Gabrr2 A G 4: 33,082,566 (GRCm39) D230G probably damaging Het
Gen1 A T 12: 11,291,465 (GRCm39) S840T probably benign Het
Glyctk G A 9: 106,034,892 (GRCm39) T58I probably benign Het
Gm12258 G A 11: 58,750,138 (GRCm39) A438T unknown Het
Gm14305 A G 2: 176,413,298 (GRCm39) T397A probably benign Het
Hnrnpu G T 1: 178,165,067 (GRCm39) R24S possibly damaging Het
Iffo2 A G 4: 139,302,265 (GRCm39) N3D possibly damaging Het
Insr C T 8: 3,308,660 (GRCm39) M125I probably damaging Het
Itsn1 G A 16: 91,615,446 (GRCm39) R397H unknown Het
Kcnj16 T A 11: 110,915,341 (GRCm39) M1K probably null Het
Kcns3 G A 12: 11,169,764 (GRCm39) probably benign Het
Kmt2c A G 5: 25,579,562 (GRCm39) V578A probably benign Het
Krt79 T C 15: 101,839,137 (GRCm39) K444R probably damaging Het
Mtg2 T C 2: 179,727,368 (GRCm39) V340A probably benign Het
Mtr A C 13: 12,236,372 (GRCm39) L618R probably damaging Het
Myo6 T A 9: 80,124,991 (GRCm39) D23E unknown Het
Nos1ap A G 1: 170,218,328 (GRCm39) V27A probably damaging Het
Npc1 A T 18: 12,328,129 (GRCm39) I1060K possibly damaging Het
Nrbp1 T A 5: 31,401,193 (GRCm39) L23* probably null Het
Or10ag52 T C 2: 87,044,148 (GRCm39) I304T probably damaging Het
Or1p1c A T 11: 74,160,544 (GRCm39) M110L probably benign Het
Or6c6c A T 10: 129,540,753 (GRCm39) K2I possibly damaging Het
Or8b3 C A 9: 38,314,803 (GRCm39) T211K probably damaging Het
Or9s13 G A 1: 92,548,078 (GRCm39) R150H probably benign Het
Pcdhgc5 A T 18: 37,954,615 (GRCm39) T630S probably damaging Het
Pgm2 C A 5: 64,269,503 (GRCm39) T530K probably damaging Het
Phf20l1 A T 15: 66,475,922 (GRCm39) N185I probably damaging Het
Pkp2 A G 16: 16,031,313 (GRCm39) D26G probably damaging Het
Rangap1 C T 15: 81,594,696 (GRCm39) E378K probably benign Het
Rapgef1 A C 2: 29,569,210 (GRCm39) I43L probably benign Het
Rbfox1 A G 16: 7,094,892 (GRCm39) T111A Het
Rptn GCAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCA GCAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCA 3: 93,304,000 (GRCm39) probably benign Het
Spata16 A T 3: 26,894,811 (GRCm39) M287L probably benign Het
Speer4a2 T C 5: 26,289,690 (GRCm39) S246G possibly damaging Het
Stau2 A G 1: 16,416,049 (GRCm39) M470T probably benign Het
Tcf12 T C 9: 71,922,933 (GRCm39) Y70C probably damaging Het
Tsc22d1 C T 14: 76,654,460 (GRCm39) T313M probably benign Het
Vmn1r52 T A 6: 90,156,239 (GRCm39) M181K possibly damaging Het
Zbtb48 A T 4: 152,106,567 (GRCm39) C345S probably damaging Het
Zfp628 G A 7: 4,921,958 (GRCm39) R60Q probably damaging Het
Zfp638 T C 6: 83,906,713 (GRCm39) S293P possibly damaging Het
Zkscan17 G A 11: 59,393,770 (GRCm39) P183S probably benign Het
Zscan12 G T 13: 21,547,897 (GRCm39) K26N probably benign Het
Other mutations in Arhgef5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Arhgef5 APN 6 43,257,203 (GRCm39) nonsense probably null
IGL01341:Arhgef5 APN 6 43,260,925 (GRCm39) missense probably damaging 1.00
IGL01576:Arhgef5 APN 6 43,250,962 (GRCm39) missense probably benign 0.38
IGL01761:Arhgef5 APN 6 43,251,538 (GRCm39) missense probably benign 0.00
IGL02104:Arhgef5 APN 6 43,249,345 (GRCm39) missense probably damaging 0.99
IGL02208:Arhgef5 APN 6 43,252,064 (GRCm39) missense probably benign 0.11
IGL02487:Arhgef5 APN 6 43,260,916 (GRCm39) missense probably damaging 1.00
IGL02650:Arhgef5 APN 6 43,249,869 (GRCm39) nonsense probably null
IGL03292:Arhgef5 APN 6 43,257,180 (GRCm39) missense probably damaging 1.00
IGL03334:Arhgef5 APN 6 43,250,934 (GRCm39) missense possibly damaging 0.47
IGL03341:Arhgef5 APN 6 43,257,585 (GRCm39) missense probably damaging 0.99
R0047:Arhgef5 UTSW 6 43,242,555 (GRCm39) splice site probably null
R0206:Arhgef5 UTSW 6 43,250,275 (GRCm39) missense probably damaging 1.00
R0208:Arhgef5 UTSW 6 43,250,275 (GRCm39) missense probably damaging 1.00
R0698:Arhgef5 UTSW 6 43,250,275 (GRCm39) missense probably damaging 1.00
R1145:Arhgef5 UTSW 6 43,250,022 (GRCm39) missense possibly damaging 0.92
R1145:Arhgef5 UTSW 6 43,250,022 (GRCm39) missense possibly damaging 0.92
R1168:Arhgef5 UTSW 6 43,250,330 (GRCm39) missense probably benign 0.00
R1355:Arhgef5 UTSW 6 43,260,846 (GRCm39) missense probably damaging 1.00
R1370:Arhgef5 UTSW 6 43,260,846 (GRCm39) missense probably damaging 1.00
R1481:Arhgef5 UTSW 6 43,251,568 (GRCm39) missense probably damaging 0.99
R1529:Arhgef5 UTSW 6 43,256,449 (GRCm39) missense probably damaging 0.96
R1532:Arhgef5 UTSW 6 43,250,337 (GRCm39) missense probably benign
R1663:Arhgef5 UTSW 6 43,253,899 (GRCm39) missense probably damaging 1.00
R1742:Arhgef5 UTSW 6 43,257,133 (GRCm39) missense probably damaging 1.00
R1852:Arhgef5 UTSW 6 43,252,119 (GRCm39) missense probably benign 0.00
R1869:Arhgef5 UTSW 6 43,265,616 (GRCm39) missense probably damaging 1.00
R1880:Arhgef5 UTSW 6 43,250,022 (GRCm39) missense possibly damaging 0.92
R2146:Arhgef5 UTSW 6 43,260,252 (GRCm39) missense probably damaging 1.00
R2169:Arhgef5 UTSW 6 43,251,354 (GRCm39) missense probably benign 0.11
R3412:Arhgef5 UTSW 6 43,250,724 (GRCm39) missense probably benign
R4205:Arhgef5 UTSW 6 43,250,766 (GRCm39) missense possibly damaging 0.76
R4226:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4227:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4304:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4308:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4457:Arhgef5 UTSW 6 43,251,027 (GRCm39) missense probably damaging 1.00
R4469:Arhgef5 UTSW 6 43,252,033 (GRCm39) missense probably benign
R4636:Arhgef5 UTSW 6 43,251,876 (GRCm39) missense probably benign 0.11
R4791:Arhgef5 UTSW 6 43,260,117 (GRCm39) missense probably damaging 1.00
R4818:Arhgef5 UTSW 6 43,250,484 (GRCm39) missense probably benign 0.00
R4910:Arhgef5 UTSW 6 43,249,762 (GRCm39) missense probably benign 0.01
R4911:Arhgef5 UTSW 6 43,249,762 (GRCm39) missense probably benign 0.01
R5127:Arhgef5 UTSW 6 43,250,148 (GRCm39) missense probably damaging 0.99
R5209:Arhgef5 UTSW 6 43,250,634 (GRCm39) missense probably benign 0.01
R5245:Arhgef5 UTSW 6 43,242,614 (GRCm39) start gained probably benign
R5251:Arhgef5 UTSW 6 43,249,815 (GRCm39) missense possibly damaging 0.76
R5513:Arhgef5 UTSW 6 43,249,273 (GRCm39) missense probably damaging 0.96
R5613:Arhgef5 UTSW 6 43,250,997 (GRCm39) missense probably benign 0.01
R5616:Arhgef5 UTSW 6 43,252,874 (GRCm39) missense probably benign 0.20
R5817:Arhgef5 UTSW 6 43,252,038 (GRCm39) missense probably benign 0.15
R6024:Arhgef5 UTSW 6 43,252,068 (GRCm39) missense probably benign 0.00
R6735:Arhgef5 UTSW 6 43,251,966 (GRCm39) missense probably benign 0.01
R6825:Arhgef5 UTSW 6 43,251,895 (GRCm39) missense probably damaging 0.99
R6831:Arhgef5 UTSW 6 43,257,933 (GRCm39) missense probably damaging 1.00
R6901:Arhgef5 UTSW 6 43,250,232 (GRCm39) missense probably benign 0.00
R6932:Arhgef5 UTSW 6 43,251,351 (GRCm39) missense possibly damaging 0.94
R6968:Arhgef5 UTSW 6 43,252,276 (GRCm39) missense probably benign 0.00
R7018:Arhgef5 UTSW 6 43,265,665 (GRCm39) missense probably damaging 1.00
R7180:Arhgef5 UTSW 6 43,252,142 (GRCm39) missense possibly damaging 0.87
R7201:Arhgef5 UTSW 6 43,250,166 (GRCm39) nonsense probably null
R7358:Arhgef5 UTSW 6 43,256,507 (GRCm39) missense probably damaging 1.00
R7359:Arhgef5 UTSW 6 43,257,216 (GRCm39) missense probably damaging 1.00
R7468:Arhgef5 UTSW 6 43,257,605 (GRCm39) nonsense probably null
R7503:Arhgef5 UTSW 6 43,250,933 (GRCm39) missense probably benign 0.15
R7699:Arhgef5 UTSW 6 43,251,691 (GRCm39) missense probably benign 0.11
R7700:Arhgef5 UTSW 6 43,251,691 (GRCm39) missense probably benign 0.11
R7737:Arhgef5 UTSW 6 43,250,728 (GRCm39) missense possibly damaging 0.84
R7847:Arhgef5 UTSW 6 43,252,069 (GRCm39) nonsense probably null
R7950:Arhgef5 UTSW 6 43,250,859 (GRCm39) missense possibly damaging 0.76
R8178:Arhgef5 UTSW 6 43,252,119 (GRCm39) missense probably benign 0.00
R8203:Arhgef5 UTSW 6 43,257,579 (GRCm39) missense probably damaging 1.00
R8318:Arhgef5 UTSW 6 43,252,933 (GRCm39) critical splice donor site probably null
R8857:Arhgef5 UTSW 6 43,264,558 (GRCm39) missense probably damaging 1.00
R9499:Arhgef5 UTSW 6 43,260,940 (GRCm39) missense
R9610:Arhgef5 UTSW 6 43,257,890 (GRCm39) missense probably damaging 0.99
R9611:Arhgef5 UTSW 6 43,257,890 (GRCm39) missense probably damaging 0.99
R9623:Arhgef5 UTSW 6 43,251,736 (GRCm39) missense possibly damaging 0.86
R9685:Arhgef5 UTSW 6 43,250,527 (GRCm39) missense probably benign 0.11
RF023:Arhgef5 UTSW 6 43,256,407 (GRCm39) missense probably damaging 1.00
X0028:Arhgef5 UTSW 6 43,250,635 (GRCm39) missense probably benign 0.03
X0065:Arhgef5 UTSW 6 43,249,342 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAGAGTAAGTTGAAGCCCTCATATG -3'
(R):5'- AGAAGTGCTGAGTCATGGTC -3'

Sequencing Primer
(F):5'- GCCCTCATATGGCTTTTATATGATAC -3'
(R):5'- CATGGTCTGCATATGGTTCTGACC -3'
Posted On 2020-07-13