Incidental Mutation 'R8161:Zfp638'
ID633515
Institutional Source Beutler Lab
Gene Symbol Zfp638
Ensembl Gene ENSMUSG00000030016
Gene Namezinc finger protein 638
SynonymsNp220, Zfml
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.827) question?
Stock #R8161 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location83867109-83989550 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83929731 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 293 (S293P)
Ref Sequence ENSEMBL: ENSMUSP00000144989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032088] [ENSMUST00000113835] [ENSMUST00000113836] [ENSMUST00000203273] [ENSMUST00000203324] [ENSMUST00000203455] [ENSMUST00000203891] [ENSMUST00000204202] [ENSMUST00000204415] [ENSMUST00000204751]
Predicted Effect
SMART Domains Protein: ENSMUSP00000032088
Gene: ENSMUSG00000030016
AA Change: S293P

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 9.04e-3 SMART
Blast:RRM_2 1007 1075 4e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1399 1412 N/A INTRINSIC
low complexity region 1512 1526 N/A INTRINSIC
low complexity region 1761 1771 N/A INTRINSIC
ZnF_U1 1873 1907 2.84e-8 SMART
ZnF_C2H2 1876 1900 2.14e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113835
AA Change: S293P

PolyPhen 2 Score 0.525 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109466
Gene: ENSMUSG00000030016
AA Change: S293P

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 880 949 9.04e-3 SMART
Blast:RRM_2 984 1052 2e-25 BLAST
low complexity region 1095 1109 N/A INTRINSIC
ZnF_U1 1218 1252 2.84e-8 SMART
ZnF_C2H2 1221 1245 2.14e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113836
AA Change: S293P

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109467
Gene: ENSMUSG00000030016
AA Change: S293P

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 9.04e-3 SMART
Blast:RRM_2 1007 1075 2e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
ZnF_U1 1222 1256 2.84e-8 SMART
ZnF_C2H2 1225 1249 2.14e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203273
Predicted Effect possibly damaging
Transcript: ENSMUST00000203324
AA Change: S293P

PolyPhen 2 Score 0.525 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000145124
Gene: ENSMUSG00000030016
AA Change: S293P

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 3.5e-2 SMART
ZnF_C2H2 424 448 5.9e-2 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 9.1e-9 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 3.9e-5 SMART
Blast:RRM_2 1007 1075 2e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
ZnF_U1 1220 1254 1.7e-10 SMART
ZnF_C2H2 1223 1247 8.9e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203455
AA Change: S293P

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000145047
Gene: ENSMUSG00000030016
AA Change: S293P

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
internal_repeat_1 819 891 3.29e-10 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000203891
AA Change: S293P

PolyPhen 2 Score 0.525 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000144939
Gene: ENSMUSG00000030016
AA Change: S293P

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 3.5e-2 SMART
ZnF_C2H2 424 448 5.9e-2 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 9.1e-9 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 3.9e-5 SMART
Blast:RRM_2 1007 1075 2e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
ZnF_U1 1186 1220 1.7e-10 SMART
ZnF_C2H2 1189 1213 8.9e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000204202
AA Change: S293P

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000145170
Gene: ENSMUSG00000030016
AA Change: S293P

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_C2H2 424 448 5.9e-2 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 9.1e-9 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204415
SMART Domains Protein: ENSMUSP00000145513
Gene: ENSMUSG00000030016

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 112 131 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000204751
AA Change: S293P

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144989
Gene: ENSMUSG00000030016
AA Change: S293P

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 9.04e-3 SMART
Blast:RRM_2 1007 1075 4e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1399 1412 N/A INTRINSIC
low complexity region 1512 1526 N/A INTRINSIC
low complexity region 1761 1771 N/A INTRINSIC
ZnF_U1 1873 1907 2.84e-8 SMART
ZnF_C2H2 1876 1900 2.14e0 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nucleoplasmic protein. It binds cytidine-rich sequences in double-stranded DNA. This protein has three types of domains: MH1, MH2 (repeated three times) and MH3. It is associated with packaging, transferring, or processing transcripts. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik T C 9: 101,938,769 L51P probably damaging Het
Adgrb3 A T 1: 25,093,922 M1121K probably benign Het
Ank2 T C 3: 127,032,129 N371S Het
Arhgef5 T A 6: 43,283,951 C1437S probably damaging Het
Atp8b1 A T 18: 64,556,987 L558Q probably damaging Het
Bsn T C 9: 108,139,530 K94R probably benign Het
Cacna2d1 T A 5: 16,314,937 V435D probably damaging Het
Chd3 T C 11: 69,350,885 N1474S probably damaging Het
Chd7 A G 4: 8,855,038 D2089G probably damaging Het
Col11a2 T A 17: 34,051,290 M492K unknown Het
Col16a1 A T 4: 130,060,469 T502S unknown Het
Csl A T 10: 99,758,320 N294K probably damaging Het
Dnah5 T A 15: 28,350,704 M2624K possibly damaging Het
Dync1li1 C A 9: 114,706,183 H172N probably damaging Het
Eef1a1 C T 9: 78,480,390 V59I probably benign Het
Ephb1 T C 9: 102,194,813 K256E probably damaging Het
Erlin2 C A 8: 27,028,942 T78N probably damaging Het
Fbxo10 A G 4: 45,044,793 L614P probably damaging Het
Fer1l4 A T 2: 156,024,635 D1555E probably benign Het
Gabrr2 A G 4: 33,082,566 D230G probably damaging Het
Gen1 A T 12: 11,241,464 S840T probably benign Het
Glyctk G A 9: 106,157,693 T58I probably benign Het
Gm10471 T C 5: 26,084,692 S246G possibly damaging Het
Gm12258 G A 11: 58,859,312 A438T unknown Het
Gm14305 A G 2: 176,721,505 T397A probably benign Het
Hnrnpu G T 1: 178,337,502 R24S possibly damaging Het
Iffo2 A G 4: 139,574,954 N3D possibly damaging Het
Insr C T 8: 3,258,660 M125I probably damaging Het
Itsn1 G A 16: 91,818,558 R397H unknown Het
Kcnj16 T A 11: 111,024,515 M1K probably null Het
Kcns3 G A 12: 11,119,763 probably benign Het
Kmt2c A G 5: 25,374,564 V578A probably benign Het
Krt79 T C 15: 101,930,702 K444R probably damaging Het
Mtg2 T C 2: 180,085,575 V340A probably benign Het
Mtr A C 13: 12,221,486 L618R probably damaging Het
Myo6 T A 9: 80,217,709 D23E unknown Het
Nos1ap A G 1: 170,390,759 V27A probably damaging Het
Npc1 A T 18: 12,195,072 I1060K possibly damaging Het
Nrbp1 T A 5: 31,243,849 L23* probably null Het
Olfr1113 T C 2: 87,213,804 I304T probably damaging Het
Olfr12 G A 1: 92,620,356 R150H probably benign Het
Olfr147 C A 9: 38,403,507 T211K probably damaging Het
Olfr406 A T 11: 74,269,718 M110L probably benign Het
Olfr804 A T 10: 129,704,884 K2I possibly damaging Het
Pcdhgc5 A T 18: 37,821,562 T630S probably damaging Het
Pgm1 C A 5: 64,112,160 T530K probably damaging Het
Phf20l1 A T 15: 66,604,073 N185I probably damaging Het
Pkp2 A G 16: 16,213,449 D26G probably damaging Het
Rangap1 C T 15: 81,710,495 E378K probably benign Het
Rapgef1 A C 2: 29,679,198 I43L probably benign Het
Rbfox1 A G 16: 7,277,028 T111A Het
Rptn GCAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCA GCAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCA 3: 93,396,693 probably benign Het
Spata16 A T 3: 26,840,662 M287L probably benign Het
Stau2 A G 1: 16,345,825 M470T probably benign Het
Tcf12 T C 9: 72,015,651 Y70C probably damaging Het
Tsc22d1 C T 14: 76,417,020 T313M probably benign Het
Vmn1r52 T A 6: 90,179,257 M181K possibly damaging Het
Zbtb48 A T 4: 152,022,110 C345S probably damaging Het
Zfp628 G A 7: 4,918,959 R60Q probably damaging Het
Zkscan17 G A 11: 59,502,944 P183S probably benign Het
Zscan12 G T 13: 21,363,727 K26N probably benign Het
Other mutations in Zfp638
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Zfp638 APN 6 83979718 missense probably damaging 1.00
IGL00514:Zfp638 APN 6 83956698 missense probably damaging 1.00
IGL00705:Zfp638 APN 6 83977130 missense probably damaging 1.00
IGL00785:Zfp638 APN 6 83929164 missense probably damaging 1.00
IGL01068:Zfp638 APN 6 83934994 missense probably damaging 1.00
IGL01084:Zfp638 APN 6 83944798 missense probably benign 0.01
IGL01570:Zfp638 APN 6 83947847 missense probably damaging 1.00
IGL01758:Zfp638 APN 6 83979526 missense probably damaging 0.96
IGL02345:Zfp638 APN 6 83984875 missense probably damaging 1.00
IGL02939:Zfp638 APN 6 83969232 missense probably damaging 0.98
IGL03007:Zfp638 APN 6 83984884 missense probably damaging 1.00
IGL03118:Zfp638 APN 6 83935018 splice site probably benign
IGL03135:Zfp638 APN 6 83942875 missense probably damaging 1.00
IGL03264:Zfp638 APN 6 83946247 missense probably benign 0.04
R0190:Zfp638 UTSW 6 83928964 missense probably damaging 1.00
R0200:Zfp638 UTSW 6 83967354 missense probably damaging 1.00
R0766:Zfp638 UTSW 6 83929041 missense probably damaging 1.00
R0801:Zfp638 UTSW 6 83972238 unclassified probably benign
R0938:Zfp638 UTSW 6 83984041 missense probably benign 0.16
R1312:Zfp638 UTSW 6 83929041 missense probably damaging 1.00
R1458:Zfp638 UTSW 6 83944656 missense probably damaging 1.00
R1584:Zfp638 UTSW 6 83978065 intron probably null
R1634:Zfp638 UTSW 6 83979912 splice site probably null
R1651:Zfp638 UTSW 6 83954737 missense probably benign 0.00
R2079:Zfp638 UTSW 6 83953389 critical splice donor site probably null
R2134:Zfp638 UTSW 6 83928982 missense probably damaging 1.00
R2142:Zfp638 UTSW 6 83986596 missense probably damaging 1.00
R2201:Zfp638 UTSW 6 83929518 missense probably damaging 1.00
R2422:Zfp638 UTSW 6 83966439 splice site probably benign
R4353:Zfp638 UTSW 6 83984059 missense probably damaging 0.97
R4681:Zfp638 UTSW 6 83981737 missense possibly damaging 0.50
R4716:Zfp638 UTSW 6 83979562 nonsense probably null
R4807:Zfp638 UTSW 6 83943058 missense probably damaging 1.00
R4850:Zfp638 UTSW 6 83979475 missense possibly damaging 0.92
R5079:Zfp638 UTSW 6 83929456 missense probably benign 0.03
R5236:Zfp638 UTSW 6 83976575 nonsense probably null
R5323:Zfp638 UTSW 6 83962094 missense probably damaging 0.96
R5426:Zfp638 UTSW 6 83976414 missense probably damaging 1.00
R5557:Zfp638 UTSW 6 83967363 missense probably damaging 1.00
R5570:Zfp638 UTSW 6 83979188 missense probably damaging 1.00
R5614:Zfp638 UTSW 6 83929641 missense probably damaging 1.00
R5662:Zfp638 UTSW 6 83943129 missense probably damaging 0.97
R5685:Zfp638 UTSW 6 83929987 missense probably damaging 1.00
R5689:Zfp638 UTSW 6 83929072 missense probably damaging 1.00
R5783:Zfp638 UTSW 6 83944847 missense possibly damaging 0.92
R5856:Zfp638 UTSW 6 83977065 missense probably damaging 1.00
R6310:Zfp638 UTSW 6 83867230 missense possibly damaging 0.90
R6477:Zfp638 UTSW 6 83965578 missense probably damaging 1.00
R6557:Zfp638 UTSW 6 83930110 missense probably damaging 1.00
R7084:Zfp638 UTSW 6 83953126 missense possibly damaging 0.50
R7101:Zfp638 UTSW 6 83954726 missense probably benign 0.00
R7141:Zfp638 UTSW 6 83867199 missense unknown
R7368:Zfp638 UTSW 6 83929455 missense possibly damaging 0.60
R7402:Zfp638 UTSW 6 83928688 missense possibly damaging 0.92
R7455:Zfp638 UTSW 6 83930145 missense probably damaging 1.00
R7762:Zfp638 UTSW 6 83976272 missense probably damaging 1.00
R7773:Zfp638 UTSW 6 83979214 missense probably damaging 1.00
R8090:Zfp638 UTSW 6 83929819 missense probably damaging 0.99
R8154:Zfp638 UTSW 6 83977409 missense probably damaging 1.00
R8327:Zfp638 UTSW 6 83928697 missense probably damaging 0.99
R8384:Zfp638 UTSW 6 83979765 missense probably benign 0.28
Z1088:Zfp638 UTSW 6 83944811 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATTATGGGCATGCAAGCAAATATG -3'
(R):5'- CGCTCTTGTTGGCGTAAAAC -3'

Sequencing Primer
(F):5'- TACAGAAGATCCACTTGAAGTACG -3'
(R):5'- CTTGTTGGCGTAAAACTGCATC -3'
Posted On2020-07-13