Incidental Mutation 'R8161:Vmn1r52'
ID633516
Institutional Source Beutler Lab
Gene Symbol Vmn1r52
Ensembl Gene ENSMUSG00000060816
Gene Namevomeronasal 1 receptor 52
SynonymsV1ra7, VN3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R8161 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location90174808-90181248 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 90179257 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 181 (M181K)
Ref Sequence ENSEMBL: ENSMUSP00000078760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079832]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079832
AA Change: M181K

PolyPhen 2 Score 0.726 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000078760
Gene: ENSMUSG00000060816
AA Change: M181K

DomainStartEndE-ValueType
Pfam:V1R 38 302 1e-93 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik T C 9: 101,938,769 L51P probably damaging Het
Adgrb3 A T 1: 25,093,922 M1121K probably benign Het
Ank2 T C 3: 127,032,129 N371S Het
Arhgef5 T A 6: 43,283,951 C1437S probably damaging Het
Atp8b1 A T 18: 64,556,987 L558Q probably damaging Het
Bsn T C 9: 108,139,530 K94R probably benign Het
Cacna2d1 T A 5: 16,314,937 V435D probably damaging Het
Chd3 T C 11: 69,350,885 N1474S probably damaging Het
Chd7 A G 4: 8,855,038 D2089G probably damaging Het
Col11a2 T A 17: 34,051,290 M492K unknown Het
Col16a1 A T 4: 130,060,469 T502S unknown Het
Csl A T 10: 99,758,320 N294K probably damaging Het
Dnah5 T A 15: 28,350,704 M2624K possibly damaging Het
Dync1li1 C A 9: 114,706,183 H172N probably damaging Het
Eef1a1 C T 9: 78,480,390 V59I probably benign Het
Ephb1 T C 9: 102,194,813 K256E probably damaging Het
Erlin2 C A 8: 27,028,942 T78N probably damaging Het
Fbxo10 A G 4: 45,044,793 L614P probably damaging Het
Fer1l4 A T 2: 156,024,635 D1555E probably benign Het
Gabrr2 A G 4: 33,082,566 D230G probably damaging Het
Gen1 A T 12: 11,241,464 S840T probably benign Het
Glyctk G A 9: 106,157,693 T58I probably benign Het
Gm10471 T C 5: 26,084,692 S246G possibly damaging Het
Gm12258 G A 11: 58,859,312 A438T unknown Het
Gm14305 A G 2: 176,721,505 T397A probably benign Het
Hnrnpu G T 1: 178,337,502 R24S possibly damaging Het
Iffo2 A G 4: 139,574,954 N3D possibly damaging Het
Insr C T 8: 3,258,660 M125I probably damaging Het
Itsn1 G A 16: 91,818,558 R397H unknown Het
Kcnj16 T A 11: 111,024,515 M1K probably null Het
Kcns3 G A 12: 11,119,763 probably benign Het
Kmt2c A G 5: 25,374,564 V578A probably benign Het
Krt79 T C 15: 101,930,702 K444R probably damaging Het
Mtg2 T C 2: 180,085,575 V340A probably benign Het
Mtr A C 13: 12,221,486 L618R probably damaging Het
Myo6 T A 9: 80,217,709 D23E unknown Het
Nos1ap A G 1: 170,390,759 V27A probably damaging Het
Npc1 A T 18: 12,195,072 I1060K possibly damaging Het
Nrbp1 T A 5: 31,243,849 L23* probably null Het
Olfr1113 T C 2: 87,213,804 I304T probably damaging Het
Olfr12 G A 1: 92,620,356 R150H probably benign Het
Olfr147 C A 9: 38,403,507 T211K probably damaging Het
Olfr406 A T 11: 74,269,718 M110L probably benign Het
Olfr804 A T 10: 129,704,884 K2I possibly damaging Het
Pcdhgc5 A T 18: 37,821,562 T630S probably damaging Het
Pgm1 C A 5: 64,112,160 T530K probably damaging Het
Phf20l1 A T 15: 66,604,073 N185I probably damaging Het
Pkp2 A G 16: 16,213,449 D26G probably damaging Het
Rangap1 C T 15: 81,710,495 E378K probably benign Het
Rapgef1 A C 2: 29,679,198 I43L probably benign Het
Rbfox1 A G 16: 7,277,028 T111A Het
Rptn GCAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCA GCAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCA 3: 93,396,693 probably benign Het
Spata16 A T 3: 26,840,662 M287L probably benign Het
Stau2 A G 1: 16,345,825 M470T probably benign Het
Tcf12 T C 9: 72,015,651 Y70C probably damaging Het
Tsc22d1 C T 14: 76,417,020 T313M probably benign Het
Zbtb48 A T 4: 152,022,110 C345S probably damaging Het
Zfp628 G A 7: 4,918,959 R60Q probably damaging Het
Zfp638 T C 6: 83,929,731 S293P possibly damaging Het
Zkscan17 G A 11: 59,502,944 P183S probably benign Het
Zscan12 G T 13: 21,363,727 K26N probably benign Het
Other mutations in Vmn1r52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01721:Vmn1r52 APN 6 90178923 missense probably benign
IGL02102:Vmn1r52 APN 6 90179207 missense possibly damaging 0.92
IGL02583:Vmn1r52 APN 6 90179144 nonsense probably null
IGL02938:Vmn1r52 APN 6 90179313 missense possibly damaging 0.58
R0233:Vmn1r52 UTSW 6 90179611 missense possibly damaging 0.96
R0233:Vmn1r52 UTSW 6 90179611 missense possibly damaging 0.96
R0904:Vmn1r52 UTSW 6 90179464 missense probably damaging 0.98
R2190:Vmn1r52 UTSW 6 90179169 missense probably benign 0.12
R4184:Vmn1r52 UTSW 6 90179237 missense probably benign 0.00
R4906:Vmn1r52 UTSW 6 90178948 missense possibly damaging 0.63
R5475:Vmn1r52 UTSW 6 90178912 missense probably benign 0.04
R5689:Vmn1r52 UTSW 6 90179250 missense possibly damaging 0.95
R5740:Vmn1r52 UTSW 6 90179194 missense probably benign 0.02
R7263:Vmn1r52 UTSW 6 90179553 missense probably benign 0.00
R7337:Vmn1r52 UTSW 6 90179623 missense probably benign 0.31
R7374:Vmn1r52 UTSW 6 90179136 missense probably benign 0.08
R8699:Vmn1r52 UTSW 6 90178760 missense probably benign 0.02
R8747:Vmn1r52 UTSW 6 90179469 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- TTGAGTGTCTTCCAGGCCATC -3'
(R):5'- TAGAATGGTCCTGAGGGCTC -3'

Sequencing Primer
(F):5'- GCCCTCAAAGCTCTCACTTAG -3'
(R):5'- TCCTGAGGGCTCGTTGC -3'
Posted On2020-07-13