Incidental Mutation 'R8161:Tcf12'
ID633521
Institutional Source Beutler Lab
Gene Symbol Tcf12
Ensembl Gene ENSMUSG00000032228
Gene Nametranscription factor 12
SynonymsHTF-4, ALF1, HEB, bHLHb20, HEBAlt, REB, HTF4, ME1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8161 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location71842688-72111871 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72015651 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 70 (Y70C)
Ref Sequence ENSEMBL: ENSMUSP00000139365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034755] [ENSMUST00000183404] [ENSMUST00000183492] [ENSMUST00000183594] [ENSMUST00000183992] [ENSMUST00000184072] [ENSMUST00000184107] [ENSMUST00000184523] [ENSMUST00000184783] [ENSMUST00000184867] [ENSMUST00000185117]
Predicted Effect probably damaging
Transcript: ENSMUST00000034755
AA Change: Y70C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034755
Gene: ENSMUSG00000032228
AA Change: Y70C

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 7e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
HLH 607 660 7.54e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000183404
AA Change: Y70C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139365
Gene: ENSMUSG00000032228
AA Change: Y70C

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 7e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
HLH 607 660 7.54e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000183492
AA Change: Y70C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138939
Gene: ENSMUSG00000032228
AA Change: Y70C

DomainStartEndE-ValueType
low complexity region 89 100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183594
Predicted Effect probably damaging
Transcript: ENSMUST00000183992
AA Change: Y70C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139084
Gene: ENSMUSG00000032228
AA Change: Y70C

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 5e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184072
SMART Domains Protein: ENSMUSP00000139284
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
PDB:4JOL|H 85 108 4e-8 PDB
low complexity region 116 127 N/A INTRINSIC
low complexity region 164 180 N/A INTRINSIC
low complexity region 260 271 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000184107
AA Change: Y70C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000184523
SMART Domains Protein: ENSMUSP00000138832
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
PDB:4JOL|H 173 196 6e-8 PDB
low complexity region 204 215 N/A INTRINSIC
low complexity region 252 268 N/A INTRINSIC
low complexity region 348 359 N/A INTRINSIC
low complexity region 554 568 N/A INTRINSIC
HLH 603 656 7.54e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184783
AA Change: Y70C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139364
Gene: ENSMUSG00000032228
AA Change: Y70C

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 7e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
HLH 607 660 7.54e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184867
Predicted Effect probably damaging
Transcript: ENSMUST00000185117
AA Change: Y70C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138925
Gene: ENSMUSG00000032228
AA Change: Y70C

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 7e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 534 548 N/A INTRINSIC
HLH 583 636 7.54e-10 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the basic helix-loop-helix (bHLH) E-protein family that recognizes the consensus binding site (E-box) CANNTG. This encoded protein is expressed in many tissues, among them skeletal muscle, thymus, B- and T-cells, and may participate in regulating lineage-specific gene expression through the formation of heterodimers with other bHLH E-proteins. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit postnatal lethality within two weeks of birth and a 50% reduction in the number of pro-B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik T C 9: 101,938,769 L51P probably damaging Het
Adgrb3 A T 1: 25,093,922 M1121K probably benign Het
Ank2 T C 3: 127,032,129 N371S Het
Arhgef5 T A 6: 43,283,951 C1437S probably damaging Het
Atp8b1 A T 18: 64,556,987 L558Q probably damaging Het
Bsn T C 9: 108,139,530 K94R probably benign Het
Cacna2d1 T A 5: 16,314,937 V435D probably damaging Het
Chd3 T C 11: 69,350,885 N1474S probably damaging Het
Chd7 A G 4: 8,855,038 D2089G probably damaging Het
Col11a2 T A 17: 34,051,290 M492K unknown Het
Col16a1 A T 4: 130,060,469 T502S unknown Het
Csl A T 10: 99,758,320 N294K probably damaging Het
Dnah5 T A 15: 28,350,704 M2624K possibly damaging Het
Dync1li1 C A 9: 114,706,183 H172N probably damaging Het
Eef1a1 C T 9: 78,480,390 V59I probably benign Het
Ephb1 T C 9: 102,194,813 K256E probably damaging Het
Erlin2 C A 8: 27,028,942 T78N probably damaging Het
Fbxo10 A G 4: 45,044,793 L614P probably damaging Het
Fer1l4 A T 2: 156,024,635 D1555E probably benign Het
Gabrr2 A G 4: 33,082,566 D230G probably damaging Het
Gen1 A T 12: 11,241,464 S840T probably benign Het
Glyctk G A 9: 106,157,693 T58I probably benign Het
Gm10471 T C 5: 26,084,692 S246G possibly damaging Het
Gm12258 G A 11: 58,859,312 A438T unknown Het
Gm14305 A G 2: 176,721,505 T397A probably benign Het
Hnrnpu G T 1: 178,337,502 R24S possibly damaging Het
Iffo2 A G 4: 139,574,954 N3D possibly damaging Het
Insr C T 8: 3,258,660 M125I probably damaging Het
Itsn1 G A 16: 91,818,558 R397H unknown Het
Kcnj16 T A 11: 111,024,515 M1K probably null Het
Kcns3 G A 12: 11,119,763 probably benign Het
Kmt2c A G 5: 25,374,564 V578A probably benign Het
Krt79 T C 15: 101,930,702 K444R probably damaging Het
Mtg2 T C 2: 180,085,575 V340A probably benign Het
Mtr A C 13: 12,221,486 L618R probably damaging Het
Myo6 T A 9: 80,217,709 D23E unknown Het
Nos1ap A G 1: 170,390,759 V27A probably damaging Het
Npc1 A T 18: 12,195,072 I1060K possibly damaging Het
Nrbp1 T A 5: 31,243,849 L23* probably null Het
Olfr1113 T C 2: 87,213,804 I304T probably damaging Het
Olfr12 G A 1: 92,620,356 R150H probably benign Het
Olfr147 C A 9: 38,403,507 T211K probably damaging Het
Olfr406 A T 11: 74,269,718 M110L probably benign Het
Olfr804 A T 10: 129,704,884 K2I possibly damaging Het
Pcdhgc5 A T 18: 37,821,562 T630S probably damaging Het
Pgm1 C A 5: 64,112,160 T530K probably damaging Het
Phf20l1 A T 15: 66,604,073 N185I probably damaging Het
Pkp2 A G 16: 16,213,449 D26G probably damaging Het
Rangap1 C T 15: 81,710,495 E378K probably benign Het
Rapgef1 A C 2: 29,679,198 I43L probably benign Het
Rbfox1 A G 16: 7,277,028 T111A Het
Rptn GCAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCA GCAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCA 3: 93,396,693 probably benign Het
Spata16 A T 3: 26,840,662 M287L probably benign Het
Stau2 A G 1: 16,345,825 M470T probably benign Het
Tsc22d1 C T 14: 76,417,020 T313M probably benign Het
Vmn1r52 T A 6: 90,179,257 M181K possibly damaging Het
Zbtb48 A T 4: 152,022,110 C345S probably damaging Het
Zfp628 G A 7: 4,918,959 R60Q probably damaging Het
Zfp638 T C 6: 83,929,731 S293P possibly damaging Het
Zkscan17 G A 11: 59,502,944 P183S probably benign Het
Zscan12 G T 13: 21,363,727 K26N probably benign Het
Other mutations in Tcf12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Tcf12 APN 9 71868118 missense probably damaging 0.98
IGL01311:Tcf12 APN 9 71858656 splice site probably benign
IGL01734:Tcf12 APN 9 71922648 splice site probably null
IGL01768:Tcf12 APN 9 71868996 splice site probably null
IGL02625:Tcf12 APN 9 71922757 missense probably damaging 1.00
IGL02671:Tcf12 APN 9 72109717 missense probably damaging 1.00
IGL03395:Tcf12 APN 9 71876022 missense probably damaging 1.00
Beneath UTSW 9 71883103 splice site probably null
depauperate UTSW 9 71868268 missense probably damaging 1.00
Poorly UTSW 9 71944016 nonsense probably null
Poorly2 UTSW 9 71858929 missense probably damaging 1.00
Poorly3 UTSW 9 72015636 critical splice donor site probably null
Substandard UTSW 9 71858840 missense probably null 0.54
R0183:Tcf12 UTSW 9 71917027 missense probably damaging 0.99
R0257:Tcf12 UTSW 9 71858622 missense probably benign 0.05
R1126:Tcf12 UTSW 9 72000433 missense probably benign 0.09
R1520:Tcf12 UTSW 9 71883106 critical splice donor site probably null
R1690:Tcf12 UTSW 9 71870072 critical splice donor site probably null
R1819:Tcf12 UTSW 9 72109717 missense probably damaging 1.00
R1850:Tcf12 UTSW 9 71868215 missense probably damaging 1.00
R1888:Tcf12 UTSW 9 71858534 missense possibly damaging 0.89
R1888:Tcf12 UTSW 9 71858534 missense possibly damaging 0.89
R2402:Tcf12 UTSW 9 71856510 missense probably damaging 1.00
R4445:Tcf12 UTSW 9 71869063 missense probably damaging 0.99
R4693:Tcf12 UTSW 9 71868967 intron probably benign
R4814:Tcf12 UTSW 9 71870041 intron probably benign
R4860:Tcf12 UTSW 9 71858840 missense probably null 0.54
R4860:Tcf12 UTSW 9 71858840 missense probably null 0.54
R4885:Tcf12 UTSW 9 71858840 missense probably null 0.54
R5347:Tcf12 UTSW 9 71885243 missense probably damaging 1.00
R5422:Tcf12 UTSW 9 71869038 missense probably damaging 1.00
R5650:Tcf12 UTSW 9 71885302 splice site probably null
R5713:Tcf12 UTSW 9 71885263 makesense probably null
R5789:Tcf12 UTSW 9 71885236 missense probably damaging 1.00
R5964:Tcf12 UTSW 9 71868240 missense probably damaging 1.00
R6012:Tcf12 UTSW 9 71858947 missense possibly damaging 0.62
R6119:Tcf12 UTSW 9 71868265 missense probably damaging 1.00
R6240:Tcf12 UTSW 9 71944016 nonsense probably null
R6299:Tcf12 UTSW 9 71858929 missense probably damaging 1.00
R6449:Tcf12 UTSW 9 71868268 missense probably damaging 1.00
R6489:Tcf12 UTSW 9 72015636 critical splice donor site probably null
R6984:Tcf12 UTSW 9 72006759 nonsense probably null
R7146:Tcf12 UTSW 9 71883103 splice site probably null
R7734:Tcf12 UTSW 9 71922661 missense probably benign 0.00
R8007:Tcf12 UTSW 9 71934623 intron probably benign
R8709:Tcf12 UTSW 9 71858505 missense possibly damaging 0.62
R8709:Tcf12 UTSW 9 71922787 missense probably benign 0.00
R8711:Tcf12 UTSW 9 71849815 missense possibly damaging 0.77
X0021:Tcf12 UTSW 9 71883172 missense probably damaging 0.99
X0022:Tcf12 UTSW 9 72109743 missense probably damaging 0.99
Z1177:Tcf12 UTSW 9 72000460 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TGTAGGCAAAGCAGATCTGG -3'
(R):5'- GCCAGTTTCACAATGATTCTCATAC -3'

Sequencing Primer
(F):5'- GCAAAGCAGATCTGGATAATACC -3'
(R):5'- CTCATACCATCATGTGAACTTCG -3'
Posted On2020-07-13