Incidental Mutation 'R8161:Col11a2'
ID633548
Institutional Source Beutler Lab
Gene Symbol Col11a2
Ensembl Gene ENSMUSG00000024330
Gene Namecollagen, type XI, alpha 2
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R8161 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location34039437-34066685 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34051290 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 492 (M492K)
Ref Sequence ENSEMBL: ENSMUSP00000122082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087497] [ENSMUST00000114252] [ENSMUST00000114255] [ENSMUST00000131134] [ENSMUST00000143354]
Predicted Effect probably damaging
Transcript: ENSMUST00000087497
AA Change: M406K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000084772
Gene: ENSMUSG00000024330
AA Change: M406K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
Pfam:Collagen 306 364 2.2e-9 PFAM
Pfam:Collagen 399 460 1e-10 PFAM
Pfam:Collagen 437 520 1.2e-7 PFAM
Pfam:Collagen 479 553 5.7e-9 PFAM
Pfam:Collagen 506 579 1.6e-8 PFAM
internal_repeat_4 584 614 3.98e-5 PROSPERO
internal_repeat_2 584 669 5.49e-20 PROSPERO
internal_repeat_1 587 740 2.58e-22 PROSPERO
Pfam:Collagen 743 814 1.5e-8 PFAM
Pfam:Collagen 767 839 4.8e-7 PFAM
low complexity region 854 872 N/A INTRINSIC
Pfam:Collagen 881 946 4.5e-8 PFAM
Pfam:Collagen 905 976 2e-7 PFAM
Pfam:Collagen 933 1002 2.7e-8 PFAM
low complexity region 1013 1047 N/A INTRINSIC
low complexity region 1064 1112 N/A INTRINSIC
low complexity region 1121 1199 N/A INTRINSIC
low complexity region 1216 1232 N/A INTRINSIC
low complexity region 1289 1320 N/A INTRINSIC
Pfam:Collagen 1358 1417 1.7e-8 PFAM
COLFI 1454 1649 4.42e-117 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114252
AA Change: M411K

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109890
Gene: ENSMUSG00000024330
AA Change: M411K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
Pfam:Collagen 311 369 2.3e-9 PFAM
Pfam:Collagen 404 465 1.1e-10 PFAM
Pfam:Collagen 442 525 1.3e-7 PFAM
Pfam:Collagen 484 558 6.4e-9 PFAM
Pfam:Collagen 511 584 1.7e-8 PFAM
internal_repeat_4 589 619 3.69e-5 PROSPERO
internal_repeat_2 589 674 4.46e-20 PROSPERO
internal_repeat_1 592 745 2.05e-22 PROSPERO
internal_repeat_3 636 752 7.84e-10 PROSPERO
Pfam:Collagen 772 844 5.5e-7 PFAM
Pfam:Collagen 800 869 1.9e-8 PFAM
Pfam:Collagen 886 951 5e-8 PFAM
Pfam:Collagen 910 981 2.2e-7 PFAM
Pfam:Collagen 934 1007 6.9e-7 PFAM
low complexity region 1018 1052 N/A INTRINSIC
low complexity region 1069 1117 N/A INTRINSIC
low complexity region 1126 1204 N/A INTRINSIC
low complexity region 1221 1237 N/A INTRINSIC
low complexity region 1294 1325 N/A INTRINSIC
Pfam:Collagen 1363 1422 1.9e-8 PFAM
COLFI 1459 1654 4.42e-117 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114255
AA Change: M445K

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109893
Gene: ENSMUSG00000024330
AA Change: M445K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
low complexity region 257 268 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
Pfam:Collagen 345 403 2.1e-9 PFAM
Pfam:Collagen 438 499 1.1e-10 PFAM
Pfam:Collagen 521 593 2.2e-8 PFAM
Pfam:Collagen 545 613 9.1e-10 PFAM
internal_repeat_4 623 653 2.83e-5 PROSPERO
internal_repeat_2 623 708 2.11e-20 PROSPERO
internal_repeat_1 626 779 9e-23 PROSPERO
internal_repeat_3 670 786 5.16e-10 PROSPERO
low complexity region 788 819 N/A INTRINSIC
low complexity region 830 857 N/A INTRINSIC
low complexity region 866 887 N/A INTRINSIC
low complexity region 893 911 N/A INTRINSIC
low complexity region 919 935 N/A INTRINSIC
Pfam:Collagen 973 1041 2.9e-8 PFAM
low complexity region 1052 1086 N/A INTRINSIC
low complexity region 1103 1151 N/A INTRINSIC
low complexity region 1160 1238 N/A INTRINSIC
low complexity region 1255 1271 N/A INTRINSIC
low complexity region 1328 1359 N/A INTRINSIC
Pfam:Collagen 1394 1456 1.5e-8 PFAM
COLFI 1493 1688 4.42e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000131134
AA Change: M492K
SMART Domains Protein: ENSMUSP00000122082
Gene: ENSMUSG00000024330
AA Change: M492K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
low complexity region 303 314 N/A INTRINSIC
low complexity region 342 354 N/A INTRINSIC
Pfam:Collagen 392 450 7.8e-10 PFAM
Pfam:Collagen 484 543 1.4e-10 PFAM
Pfam:Collagen 514 581 9.5e-11 PFAM
Pfam:Collagen 565 624 2.1e-11 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000143354
AA Change: M98K
SMART Domains Protein: ENSMUSP00000115026
Gene: ENSMUSG00000024330
AA Change: M98K

DomainStartEndE-ValueType
Pfam:Collagen 3 56 4.7e-9 PFAM
Pfam:Collagen 91 152 1.7e-9 PFAM
internal_repeat_1 158 301 3.7e-11 PROSPERO
internal_repeat_2 276 321 1.18e-9 PROSPERO
internal_repeat_4 291 306 1.06e-5 PROSPERO
internal_repeat_3 303 353 1.87e-6 PROSPERO
internal_repeat_2 315 360 1.18e-9 PROSPERO
internal_repeat_1 323 439 3.7e-11 PROSPERO
low complexity region 441 472 N/A INTRINSIC
low complexity region 483 510 N/A INTRINSIC
low complexity region 519 540 N/A INTRINSIC
low complexity region 546 564 N/A INTRINSIC
low complexity region 572 588 N/A INTRINSIC
Pfam:Collagen 603 673 6.6e-6 PFAM
Pfam:Collagen 627 694 5.4e-7 PFAM
Pfam:Collagen 660 734 3.2e-7 PFAM
Pfam:Collagen 711 770 1.1e-8 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the alpha-2 subunit of type XI collagen, one of the low abundance fibrillar collagens found in cartilage. The encoded protein, in association with other collagen subunits, forms a heterotrimeric type XI procollagen that may undergo proteolytic processing similar to the alpha-1 subunit. Mice lacking the encoded protein exhibit a mild phenotype similar to nonocular Stickler syndrome, otospondylomegaepiphyseal dysplasia (OSMED) as well as a nonsyndromic form of deafness called DFNA13. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant animals exhibit reduced body size, short snout, a slightly bulged forehead, deafness, and disorganization of chondrocytes in the growth plate of long bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik T C 9: 101,938,769 L51P probably damaging Het
Adgrb3 A T 1: 25,093,922 M1121K probably benign Het
Ank2 T C 3: 127,032,129 N371S Het
Arhgef5 T A 6: 43,283,951 C1437S probably damaging Het
Atp8b1 A T 18: 64,556,987 L558Q probably damaging Het
Bsn T C 9: 108,139,530 K94R probably benign Het
Cacna2d1 T A 5: 16,314,937 V435D probably damaging Het
Chd3 T C 11: 69,350,885 N1474S probably damaging Het
Chd7 A G 4: 8,855,038 D2089G probably damaging Het
Col16a1 A T 4: 130,060,469 T502S unknown Het
Csl A T 10: 99,758,320 N294K probably damaging Het
Dnah5 T A 15: 28,350,704 M2624K possibly damaging Het
Dync1li1 C A 9: 114,706,183 H172N probably damaging Het
Eef1a1 C T 9: 78,480,390 V59I probably benign Het
Ephb1 T C 9: 102,194,813 K256E probably damaging Het
Erlin2 C A 8: 27,028,942 T78N probably damaging Het
Fbxo10 A G 4: 45,044,793 L614P probably damaging Het
Fer1l4 A T 2: 156,024,635 D1555E probably benign Het
Gabrr2 A G 4: 33,082,566 D230G probably damaging Het
Gen1 A T 12: 11,241,464 S840T probably benign Het
Glyctk G A 9: 106,157,693 T58I probably benign Het
Gm10471 T C 5: 26,084,692 S246G possibly damaging Het
Gm12258 G A 11: 58,859,312 A438T unknown Het
Gm14305 A G 2: 176,721,505 T397A probably benign Het
Hnrnpu G T 1: 178,337,502 R24S possibly damaging Het
Iffo2 A G 4: 139,574,954 N3D possibly damaging Het
Insr C T 8: 3,258,660 M125I probably damaging Het
Itsn1 G A 16: 91,818,558 R397H unknown Het
Kcnj16 T A 11: 111,024,515 M1K probably null Het
Kcns3 G A 12: 11,119,763 probably benign Het
Kmt2c A G 5: 25,374,564 V578A probably benign Het
Krt79 T C 15: 101,930,702 K444R probably damaging Het
Mtg2 T C 2: 180,085,575 V340A probably benign Het
Mtr A C 13: 12,221,486 L618R probably damaging Het
Myo6 T A 9: 80,217,709 D23E unknown Het
Nos1ap A G 1: 170,390,759 V27A probably damaging Het
Npc1 A T 18: 12,195,072 I1060K possibly damaging Het
Nrbp1 T A 5: 31,243,849 L23* probably null Het
Olfr1113 T C 2: 87,213,804 I304T probably damaging Het
Olfr12 G A 1: 92,620,356 R150H probably benign Het
Olfr147 C A 9: 38,403,507 T211K probably damaging Het
Olfr406 A T 11: 74,269,718 M110L probably benign Het
Olfr804 A T 10: 129,704,884 K2I possibly damaging Het
Pcdhgc5 A T 18: 37,821,562 T630S probably damaging Het
Pgm1 C A 5: 64,112,160 T530K probably damaging Het
Phf20l1 A T 15: 66,604,073 N185I probably damaging Het
Pkp2 A G 16: 16,213,449 D26G probably damaging Het
Rangap1 C T 15: 81,710,495 E378K probably benign Het
Rapgef1 A C 2: 29,679,198 I43L probably benign Het
Rbfox1 A G 16: 7,277,028 T111A Het
Rptn GCAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCA GCAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCA 3: 93,396,693 probably benign Het
Spata16 A T 3: 26,840,662 M287L probably benign Het
Stau2 A G 1: 16,345,825 M470T probably benign Het
Tcf12 T C 9: 72,015,651 Y70C probably damaging Het
Tsc22d1 C T 14: 76,417,020 T313M probably benign Het
Vmn1r52 T A 6: 90,179,257 M181K possibly damaging Het
Zbtb48 A T 4: 152,022,110 C345S probably damaging Het
Zfp628 G A 7: 4,918,959 R60Q probably damaging Het
Zfp638 T C 6: 83,929,731 S293P possibly damaging Het
Zkscan17 G A 11: 59,502,944 P183S probably benign Het
Zscan12 G T 13: 21,363,727 K26N probably benign Het
Other mutations in Col11a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01723:Col11a2 APN 17 34061280 unclassified probably benign
IGL01839:Col11a2 APN 17 34064082 unclassified probably benign
IGL02429:Col11a2 APN 17 34042292 missense probably damaging 1.00
IGL02491:Col11a2 APN 17 34064207 unclassified probably benign
BB010:Col11a2 UTSW 17 34056055 nonsense probably null
BB020:Col11a2 UTSW 17 34056055 nonsense probably null
PIT4531001:Col11a2 UTSW 17 34046438 critical splice acceptor site probably null
R0001:Col11a2 UTSW 17 34061612 missense probably benign 0.00
R0005:Col11a2 UTSW 17 34062879 unclassified probably benign
R0099:Col11a2 UTSW 17 34049674 missense probably damaging 0.99
R0106:Col11a2 UTSW 17 34057275 missense probably damaging 0.99
R0243:Col11a2 UTSW 17 34062546 unclassified probably benign
R0254:Col11a2 UTSW 17 34064803 unclassified probably benign
R0352:Col11a2 UTSW 17 34042527 missense probably benign 0.43
R0362:Col11a2 UTSW 17 34062446 splice site probably null
R0491:Col11a2 UTSW 17 34042212 missense probably null 0.00
R0531:Col11a2 UTSW 17 34058377 splice site probably benign
R0538:Col11a2 UTSW 17 34051328 splice site probably benign
R0646:Col11a2 UTSW 17 34059348 critical splice donor site probably null
R0676:Col11a2 UTSW 17 34057275 missense probably damaging 0.99
R0919:Col11a2 UTSW 17 34059150 missense possibly damaging 0.93
R1522:Col11a2 UTSW 17 34055254 missense probably damaging 1.00
R1767:Col11a2 UTSW 17 34063895 unclassified probably benign
R1872:Col11a2 UTSW 17 34062555 unclassified probably benign
R1941:Col11a2 UTSW 17 34044951 missense probably benign 0.01
R1945:Col11a2 UTSW 17 34059168 missense probably damaging 1.00
R2101:Col11a2 UTSW 17 34052169 missense probably damaging 1.00
R2161:Col11a2 UTSW 17 34064797 unclassified probably benign
R2258:Col11a2 UTSW 17 34039677 missense probably benign
R2259:Col11a2 UTSW 17 34039677 missense probably benign
R2260:Col11a2 UTSW 17 34039677 missense probably benign
R2761:Col11a2 UTSW 17 34051026 missense probably damaging 1.00
R3114:Col11a2 UTSW 17 34046468 missense possibly damaging 0.69
R3824:Col11a2 UTSW 17 34054180 missense probably damaging 1.00
R3938:Col11a2 UTSW 17 34039625 unclassified probably benign
R4039:Col11a2 UTSW 17 34045774 missense probably benign 0.00
R4675:Col11a2 UTSW 17 34064293 critical splice donor site probably null
R4810:Col11a2 UTSW 17 34057112 missense probably damaging 0.99
R4824:Col11a2 UTSW 17 34050963 missense probably damaging 1.00
R4944:Col11a2 UTSW 17 34042190 missense possibly damaging 0.47
R5112:Col11a2 UTSW 17 34064088 unclassified probably benign
R5355:Col11a2 UTSW 17 34051801 missense probably benign 0.07
R5384:Col11a2 UTSW 17 34059174 critical splice donor site probably null
R5534:Col11a2 UTSW 17 34051024 missense probably damaging 0.99
R5860:Col11a2 UTSW 17 34064185 unclassified probably benign
R6252:Col11a2 UTSW 17 34042212 missense probably null 0.00
R6327:Col11a2 UTSW 17 34043317 missense probably benign 0.32
R6828:Col11a2 UTSW 17 34053633 splice site probably null
R6860:Col11a2 UTSW 17 34053598 missense probably damaging 1.00
R6873:Col11a2 UTSW 17 34065019 missense unknown
R6992:Col11a2 UTSW 17 34047144 missense probably benign 0.01
R7292:Col11a2 UTSW 17 34051508 missense unknown
R7543:Col11a2 UTSW 17 34050456 missense unknown
R7933:Col11a2 UTSW 17 34056055 nonsense probably null
R8157:Col11a2 UTSW 17 34061256 missense unknown
R8209:Col11a2 UTSW 17 34047279 critical splice donor site probably null
X0017:Col11a2 UTSW 17 34059985 critical splice donor site probably null
X0064:Col11a2 UTSW 17 34042247 missense possibly damaging 0.88
Z1176:Col11a2 UTSW 17 34056402 missense unknown
Z1177:Col11a2 UTSW 17 34051666 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- CAGTTCCGGTTTGGCAGTAG -3'
(R):5'- AACTCGTGGAAGGGCACAAC -3'

Sequencing Primer
(F):5'- AGGCGATTCTGCAGCAG -3'
(R):5'- TGGAAGGGCACAACCAACAG -3'
Posted On2020-07-13