Incidental Mutation 'R8162:Farp2'
ID633553
Institutional Source Beutler Lab
Gene Symbol Farp2
Ensembl Gene ENSMUSG00000034066
Gene NameFERM, RhoGEF and pleckstrin domain protein 2
SynonymsFir, D030026M03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8162 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location93512079-93621976 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 93620603 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 1003 (H1003Q)
Ref Sequence ENSEMBL: ENSMUSP00000112725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027498] [ENSMUST00000120301]
PDB Structure
Crystal strucure of the DH domain of FARP2 [X-RAY DIFFRACTION]
Crystal strucure of the DH-PH-PH domain of FARP2 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000027498
SMART Domains Protein: ENSMUSP00000027498
Gene: ENSMUSG00000026277

DomainStartEndE-ValueType
S_TKc 20 270 2.92e-98 SMART
low complexity region 292 314 N/A INTRINSIC
PDB:3W8H|B 355 426 8e-43 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000120301
AA Change: H1003Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112725
Gene: ENSMUSG00000034066
AA Change: H1003Q

DomainStartEndE-ValueType
B41 40 234 1.48e-66 SMART
FERM_C 238 328 3.29e-35 SMART
FA 332 378 1.13e-15 SMART
low complexity region 409 421 N/A INTRINSIC
low complexity region 440 459 N/A INTRINSIC
low complexity region 462 473 N/A INTRINSIC
low complexity region 478 492 N/A INTRINSIC
RhoGEF 542 728 1.57e-56 SMART
PH 759 857 1.45e-19 SMART
low complexity region 879 890 N/A INTRINSIC
PH 931 1029 2.62e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 98% (47/48)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit slight increase in bone volumetrics and reduced osteoclast differentiation from BMDMs cultured with M-CSF and RANKL [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7b T A 15: 77,423,230 Q355L probably benign Het
Asb14 A T 14: 26,911,988 Q383H probably benign Het
Ash1l T G 3: 89,070,246 M2661R probably damaging Het
Cacna1e G T 1: 154,701,567 probably null Het
Ccdc40 G T 11: 119,260,044 probably null Het
Cd27 T A 6: 125,233,225 probably null Het
Ces3b T C 8: 105,090,753 L371S possibly damaging Het
Clec4a2 T A 6: 123,140,752 Y210N probably damaging Het
Cpeb2 A T 5: 43,237,338 H553L Het
Cpne8 T C 15: 90,619,678 I95V probably benign Het
D630039A03Rik T C 4: 57,910,525 T96A probably benign Het
Dand5 C A 8: 84,816,518 G110C probably damaging Het
Erich3 C T 3: 154,764,573 T1554M unknown Het
Evi5l T C 8: 4,191,300 S278P probably damaging Het
Fam208b G T 13: 3,599,691 T36N probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gm13741 A C 2: 87,656,102 M273R possibly damaging Het
Gm28363 T A 1: 117,698,911 D26E unknown Het
Gm8674 A T 13: 49,900,371 D700E noncoding transcript Het
Gm9008 C A 6: 76,496,575 A353S probably benign Het
Gtf3c4 G A 2: 28,834,581 Q380* probably null Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Il1a A T 2: 129,306,557 S78T possibly damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Mcc T C 18: 44,449,441 probably null Het
Met A G 6: 17,547,062 D898G probably damaging Het
Mogs T C 6: 83,115,882 V101A probably damaging Het
Mrgpra4 A T 7: 47,981,473 Y127N probably damaging Het
Ms4a18 A G 19: 11,013,707 S8P probably benign Het
Muc4 A T 16: 32,750,379 T148S unknown Het
Nutm1 G A 2: 112,248,472 L1033F probably benign Het
Ocstamp G T 2: 165,397,867 A133D probably damaging Het
Olfr146 T A 9: 39,018,953 D196V probably benign Het
Olfr374 T G 8: 72,110,409 V281G noncoding transcript Het
Olfr466 G A 13: 65,152,920 R232Q probably damaging Het
Olfr487 T C 7: 108,211,788 H247R probably damaging Het
Papd4 A G 13: 93,167,924 probably null Het
Phf12 C A 11: 78,024,825 P46Q probably damaging Het
Prf1 A G 10: 61,302,970 T236A probably damaging Het
Ptcd3 A G 6: 71,907,814 V47A probably benign Het
Rapgef1 A T 2: 29,735,999 N1071Y probably damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Tango6 C T 8: 106,683,250 P33L possibly damaging Het
Tbc1d2b C T 9: 90,207,884 R864H probably damaging Het
Trav10n A T 14: 53,122,472 I69L probably benign Het
Tsks A G 7: 44,953,872 Q366R probably damaging Het
Vcan G T 13: 89,704,987 S618* probably null Het
Vwf T A 6: 125,645,836 probably null Het
Zfp827 T A 8: 79,060,577 L124* probably null Het
Other mutations in Farp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Farp2 APN 1 93603381 missense probably benign 0.00
IGL00953:Farp2 APN 1 93561174 missense possibly damaging 0.92
IGL00961:Farp2 APN 1 93621313 missense possibly damaging 0.81
IGL00970:Farp2 APN 1 93560327 missense probably benign 0.00
IGL01377:Farp2 APN 1 93603459 missense possibly damaging 0.74
IGL01408:Farp2 APN 1 93618980 missense probably benign 0.19
IGL01919:Farp2 APN 1 93576433 missense probably damaging 1.00
IGL01985:Farp2 APN 1 93607602 missense probably damaging 1.00
IGL02375:Farp2 APN 1 93576463 missense probably damaging 1.00
IGL02392:Farp2 APN 1 93577650 missense probably damaging 1.00
IGL02815:Farp2 APN 1 93560285 missense probably damaging 1.00
IGL03003:Farp2 APN 1 93567418 missense probably damaging 1.00
IGL03074:Farp2 APN 1 93560327 missense probably benign 0.00
IGL03223:Farp2 APN 1 93617602 nonsense probably null
IGL03379:Farp2 APN 1 93607438 missense probably benign 0.08
IGL02802:Farp2 UTSW 1 93528610 missense probably damaging 1.00
PIT4468001:Farp2 UTSW 1 93528777 nonsense probably null
PIT4494001:Farp2 UTSW 1 93617594 missense probably damaging 1.00
R0207:Farp2 UTSW 1 93569087 missense probably damaging 0.96
R0521:Farp2 UTSW 1 93576821 critical splice acceptor site probably null
R0594:Farp2 UTSW 1 93576500 missense probably damaging 1.00
R1386:Farp2 UTSW 1 93620151 splice site probably null
R1522:Farp2 UTSW 1 93618553 missense possibly damaging 0.79
R1589:Farp2 UTSW 1 93579860 missense probably damaging 1.00
R1651:Farp2 UTSW 1 93603469 critical splice donor site probably null
R1695:Farp2 UTSW 1 93560325 missense probably damaging 0.97
R1833:Farp2 UTSW 1 93576364 splice site probably benign
R1915:Farp2 UTSW 1 93528702 missense probably benign 0.16
R2241:Farp2 UTSW 1 93579903 missense probably benign 0.31
R4505:Farp2 UTSW 1 93619010 missense probably damaging 1.00
R4518:Farp2 UTSW 1 93620641 missense probably benign 0.04
R4551:Farp2 UTSW 1 93618592 missense possibly damaging 0.92
R4723:Farp2 UTSW 1 93580899 missense probably benign 0.07
R4821:Farp2 UTSW 1 93574470 splice site probably null
R4861:Farp2 UTSW 1 93605419 missense probably damaging 1.00
R4861:Farp2 UTSW 1 93605419 missense probably damaging 1.00
R5221:Farp2 UTSW 1 93576418 missense probably damaging 0.99
R5625:Farp2 UTSW 1 93528748 missense probably damaging 1.00
R5663:Farp2 UTSW 1 93570013 missense probably damaging 1.00
R5935:Farp2 UTSW 1 93620645 critical splice donor site probably null
R6593:Farp2 UTSW 1 93569940 missense possibly damaging 0.48
R6853:Farp2 UTSW 1 93570016 missense probably damaging 1.00
R7001:Farp2 UTSW 1 93620184 missense possibly damaging 0.94
R7001:Farp2 UTSW 1 93620230 missense possibly damaging 0.94
R7133:Farp2 UTSW 1 93621234 missense probably damaging 1.00
R7134:Farp2 UTSW 1 93603459 missense probably benign 0.04
R7184:Farp2 UTSW 1 93603415 missense probably damaging 1.00
R7219:Farp2 UTSW 1 93560318 missense probably damaging 0.97
R7234:Farp2 UTSW 1 93580119 missense possibly damaging 0.94
R7426:Farp2 UTSW 1 93621228 missense possibly damaging 0.55
R7477:Farp2 UTSW 1 93581028 splice site probably null
R7503:Farp2 UTSW 1 93567497 missense probably benign 0.03
R7921:Farp2 UTSW 1 93567515 critical splice donor site probably null
R7939:Farp2 UTSW 1 93560261 missense probably damaging 1.00
R7985:Farp2 UTSW 1 93576524 missense probably damaging 1.00
R8207:Farp2 UTSW 1 93621243 missense probably benign 0.00
R8292:Farp2 UTSW 1 93528628 missense probably damaging 1.00
Z1176:Farp2 UTSW 1 93580136 missense probably benign
Z1176:Farp2 UTSW 1 93580461 missense probably benign
Z1176:Farp2 UTSW 1 93580467 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCACTTTCTTGGGAGAGTCAG -3'
(R):5'- TCCAGAAGTCCTTTGGTCATTG -3'

Sequencing Primer
(F):5'- TTCTTGGGAGAGTCAGTGGTACAAAG -3'
(R):5'- GGTCATTGTATGTATGCACACATG -3'
Posted On2020-07-13