Incidental Mutation 'R8162:Il1a'
ID633559
Institutional Source Beutler Lab
Gene Symbol Il1a
Ensembl Gene ENSMUSG00000027399
Gene Nameinterleukin 1 alpha
SynonymsIl-1a
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8162 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location129299610-129309972 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129306557 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 78 (S78T)
Ref Sequence ENSEMBL: ENSMUSP00000028882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028882]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028882
AA Change: S78T

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028882
Gene: ENSMUSG00000027399
AA Change: S78T

DomainStartEndE-ValueType
Pfam:IL1_propep 1 111 2.2e-38 PFAM
IL1 131 270 8.14e-70 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the interleukin 1 cytokine family. This cytokine is a pleiotropic cytokine involved in various immune responses, inflammatory processes, and hematopoiesis. This cytokine is produced by monocytes and macrophages as a proprotein, which is proteolytically processed and released in response to cell injury, and thus induces apoptosis. This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. It has been suggested that the polymorphism of these genes is associated with rheumatoid arthritis and Alzheimer's disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal tumor vascularization, decreased metastatic potential, and decreased interleukin-1 beta secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7b T A 15: 77,423,230 Q355L probably benign Het
Asb14 A T 14: 26,911,988 Q383H probably benign Het
Ash1l T G 3: 89,070,246 M2661R probably damaging Het
Ccdc40 G T 11: 119,260,044 probably null Het
Ces3b T C 8: 105,090,753 L371S possibly damaging Het
Clec4a2 T A 6: 123,140,752 Y210N probably damaging Het
Cpeb2 A T 5: 43,237,338 H553L Het
Cpne8 T C 15: 90,619,678 I95V probably benign Het
D630039A03Rik T C 4: 57,910,525 T96A probably benign Het
Dand5 C A 8: 84,816,518 G110C probably damaging Het
Erich3 C T 3: 154,764,573 T1554M unknown Het
Evi5l T C 8: 4,191,300 S278P probably damaging Het
Fam208b G T 13: 3,599,691 T36N probably damaging Het
Farp2 C A 1: 93,620,603 H1003Q probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gm13741 A C 2: 87,656,102 M273R possibly damaging Het
Gm28363 T A 1: 117,698,911 D26E unknown Het
Gm8674 A T 13: 49,900,371 D700E noncoding transcript Het
Gm9008 C A 6: 76,496,575 A353S probably benign Het
Gtf3c4 G A 2: 28,834,581 Q380* probably null Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Mcc T C 18: 44,449,441 probably null Het
Met A G 6: 17,547,062 D898G probably damaging Het
Mogs T C 6: 83,115,882 V101A probably damaging Het
Mrgpra4 A T 7: 47,981,473 Y127N probably damaging Het
Ms4a18 A G 19: 11,013,707 S8P probably benign Het
Muc4 A T 16: 32,750,379 T148S unknown Het
Nutm1 G A 2: 112,248,472 L1033F probably benign Het
Ocstamp G T 2: 165,397,867 A133D probably damaging Het
Olfr146 T A 9: 39,018,953 D196V probably benign Het
Olfr374 T G 8: 72,110,409 V281G noncoding transcript Het
Olfr466 G A 13: 65,152,920 R232Q probably damaging Het
Olfr487 T C 7: 108,211,788 H247R probably damaging Het
Papd4 A G 13: 93,167,924 probably null Het
Prf1 A G 10: 61,302,970 T236A probably damaging Het
Ptcd3 A G 6: 71,907,814 V47A probably benign Het
Rapgef1 A T 2: 29,735,999 N1071Y probably damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Tango6 C T 8: 106,683,250 P33L possibly damaging Het
Tbc1d2b C T 9: 90,207,884 R864H probably damaging Het
Trav10n A T 14: 53,122,472 I69L probably benign Het
Tsks A G 7: 44,953,872 Q366R probably damaging Het
Vcan G T 13: 89,704,987 S618* probably null Het
Zfp827 T A 8: 79,060,577 L124* probably null Het
Other mutations in Il1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01663:Il1a APN 2 129304717 missense probably benign
IGL01726:Il1a APN 2 129304720 missense possibly damaging 0.47
IGL02451:Il1a APN 2 129306655 missense probably damaging 0.98
IGL02537:Il1a APN 2 129309076 missense probably damaging 0.98
R0009:Il1a UTSW 2 129309074 missense probably damaging 0.99
R0009:Il1a UTSW 2 129309074 missense probably damaging 0.99
R0759:Il1a UTSW 2 129304687 missense probably damaging 1.00
R1388:Il1a UTSW 2 129306581 missense possibly damaging 0.92
R1521:Il1a UTSW 2 129304741 missense possibly damaging 0.83
R1699:Il1a UTSW 2 129302893 missense probably damaging 0.98
R3833:Il1a UTSW 2 129306679 missense possibly damaging 0.81
R4591:Il1a UTSW 2 129306527 missense probably damaging 1.00
R4643:Il1a UTSW 2 129304703 missense probably benign
R5433:Il1a UTSW 2 129307901 missense possibly damaging 0.79
R5572:Il1a UTSW 2 129307918 missense possibly damaging 0.83
R7345:Il1a UTSW 2 129304773 missense probably benign
R7876:Il1a UTSW 2 129300842 missense probably damaging 1.00
R7959:Il1a UTSW 2 129300842 missense probably damaging 1.00
R8116:Il1a UTSW 2 129302944 missense probably damaging 1.00
R8248:Il1a UTSW 2 129302961 missense probably benign
RF003:Il1a UTSW 2 129302932 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- CGGTTGTTAATTTAGTCCCAGGC -3'
(R):5'- AAGCCTGCAGGATACAGATC -3'

Sequencing Primer
(F):5'- AGTCCCAGGCTTTATTTTCTTTCCAC -3'
(R):5'- CTCAAGGGCATAGATAACTTCTCAGG -3'
Posted On2020-07-13