Incidental Mutation 'R0106:Dscc1'
ID 63356
Institutional Source Beutler Lab
Gene Symbol Dscc1
Ensembl Gene ENSMUSG00000022422
Gene Name DNA replication and sister chromatid cohesion 1
Synonyms 2600005O03Rik, 2010006I05Rik
MMRRC Submission 038392-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock # R0106 (G1)
Quality Score 81
Status Validated
Chromosome 15
Chromosomal Location 55076099-55090491 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 55083570 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 253 (C253F)
Ref Sequence ENSEMBL: ENSMUSP00000105860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023059] [ENSMUST00000110231]
AlphaFold Q14AI0
Predicted Effect probably benign
Transcript: ENSMUST00000023059
SMART Domains Protein: ENSMUSP00000023059
Gene: ENSMUSG00000022422

low complexity region 38 47 N/A INTRINSIC
Pfam:DUF2036 48 364 7.3e-110 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110231
AA Change: C253F

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000105860
Gene: ENSMUSG00000022422
AA Change: C253F

low complexity region 38 47 N/A INTRINSIC
Pfam:DUF2036 49 271 5.9e-62 PFAM
Pfam:DUF2036 284 426 4.3e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228250
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CHTF18 (MIM 613201), CHTF8 (MIM 613202), and DSCC1 are components of an alternative replication factor C (RFC) (see MIM 600404) complex that loads PCNA (MIM 176740) onto DNA during S phase of the cell cycle (Merkle et al., 2003 [PubMed 12766176]; Bermudez et al., 2003 [PubMed 12930902]).[supplied by OMIM, Dec 2009]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730018C14Rik A T 12: 112,415,194 noncoding transcript Het
Abcb9 T C 5: 124,083,060 N276S possibly damaging Het
Arhgef25 A G 10: 127,184,010 probably null Het
Asic4 T C 1: 75,451,127 V99A probably benign Het
Aspm C A 1: 139,476,876 Q1315K probably benign Het
B3galnt2 T C 13: 13,995,793 S243P probably benign Het
BC055324 T C 1: 163,982,811 probably benign Het
Brf1 A G 12: 112,973,463 probably benign Het
Card19 A C 13: 49,208,145 D3E probably benign Het
Chd6 A G 2: 160,967,902 F1480L probably damaging Het
Ckap5 T C 2: 91,578,205 I915T possibly damaging Het
Ckap5 T A 2: 91,615,840 I1836N probably damaging Het
Cpb1 T C 3: 20,266,533 probably null Het
Cramp1l A G 17: 24,972,376 V1037A probably benign Het
Cspg5 C A 9: 110,246,532 P112Q probably damaging Het
Cyp2g1 T A 7: 26,814,182 I182N probably damaging Het
Dysf C A 6: 84,113,336 F956L probably benign Het
Ephb6 T C 6: 41,619,594 probably benign Het
Fkbp6 C T 5: 135,340,004 R234Q probably benign Het
Gda T C 19: 21,397,556 D332G probably benign Het
Ggt7 C T 2: 155,494,893 A560T possibly damaging Het
Glis3 A T 19: 28,531,868 S239T possibly damaging Het
Gm10845 T A 14: 79,863,204 noncoding transcript Het
H2-M5 A G 17: 36,989,142 F47L possibly damaging Het
Hsdl1 T A 8: 119,565,778 S254C probably damaging Het
Igsf6 T A 7: 121,074,454 I18F probably benign Het
Immt A G 6: 71,851,844 S128G probably benign Het
Isy1 G A 6: 87,819,185 R257W probably damaging Het
Kif13a G T 13: 46,825,347 probably benign Het
Kif14 T C 1: 136,479,924 probably benign Het
L2hgdh A T 12: 69,705,789 Y239* probably null Het
Lama3 T C 18: 12,403,982 V228A probably damaging Het
Lamp1 A G 8: 13,174,550 T405A probably damaging Het
Lpin1 A T 12: 16,540,979 N817K possibly damaging Het
Luzp1 A G 4: 136,542,685 K740E probably damaging Het
Mapk12 T C 15: 89,132,984 probably benign Het
Mdga2 A T 12: 66,716,706 N205K probably damaging Het
Myo1a A G 10: 127,719,880 I913V probably benign Het
Nat10 A G 2: 103,757,205 V55A probably damaging Het
Nlrp10 T C 7: 108,925,322 E317G possibly damaging Het
Nomo1 T C 7: 46,037,632 I72T probably damaging Het
Olfr1450 A G 19: 12,954,356 I256V probably benign Het
Olfr974 GC G 9: 39,942,823 probably null Het
Pappa2 C T 1: 158,714,977 C1780Y probably damaging Het
Pgm2l1 A G 7: 100,250,373 M65V probably benign Het
Plec C T 15: 76,176,318 E3162K probably damaging Het
Pnisr T C 4: 21,874,617 probably benign Het
Pop7 A G 5: 137,501,649 *141Q probably null Het
Prss34 A T 17: 25,298,726 D25V probably damaging Het
Ptpn1 T C 2: 167,976,418 probably benign Het
Pygb A G 2: 150,806,203 D119G probably benign Het
Racgap1 T C 15: 99,642,958 T4A possibly damaging Het
Rap1gap2 A G 11: 74,435,744 C166R probably benign Het
Rbm28 C A 6: 29,127,803 V705L probably benign Het
Rgs1 C T 1: 144,248,549 V50M probably benign Het
Rgs12 C T 5: 34,966,664 T597I probably benign Het
Ros1 T C 10: 52,142,267 N765S possibly damaging Het
Ruvbl1 A G 6: 88,473,200 R58G probably damaging Het
Scube2 A G 7: 109,846,908 probably benign Het
Serpinb10 T A 1: 107,546,744 L212Q probably damaging Het
Slc6a7 A G 18: 61,002,223 V411A probably benign Het
Slco1a6 A T 6: 142,157,390 probably benign Het
Smc1b A T 15: 85,070,819 D1077E probably damaging Het
Srek1 G A 13: 103,743,623 H476Y unknown Het
Strn3 A G 12: 51,621,788 V673A probably benign Het
Tepsin T C 11: 120,091,811 probably null Het
Timmdc1 A C 16: 38,522,362 L58R probably damaging Het
Tmem132c T C 5: 127,554,669 V664A possibly damaging Het
Tmem241 A T 18: 12,106,009 probably benign Het
Tmprss15 T C 16: 79,003,389 D602G probably damaging Het
Trbv15 T C 6: 41,141,265 probably benign Het
Wdr70 A T 15: 8,019,587 probably null Het
Other mutations in Dscc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01121:Dscc1 APN 15 55082325 splice site probably benign
IGL01879:Dscc1 APN 15 55086816 missense probably benign 0.21
BB001:Dscc1 UTSW 15 55082176 missense probably benign 0.03
BB011:Dscc1 UTSW 15 55082176 missense probably benign 0.03
PIT4498001:Dscc1 UTSW 15 55082315 missense probably benign 0.00
PIT4812001:Dscc1 UTSW 15 55082261 missense probably damaging 1.00
R0106:Dscc1 UTSW 15 55083570 missense probably benign 0.10
R0594:Dscc1 UTSW 15 55089052 missense possibly damaging 0.69
R0616:Dscc1 UTSW 15 55083570 missense probably benign 0.10
R1458:Dscc1 UTSW 15 55086764 missense probably damaging 1.00
R1498:Dscc1 UTSW 15 55080176 splice site probably benign
R1763:Dscc1 UTSW 15 55080176 splice site probably benign
R1763:Dscc1 UTSW 15 55084139 missense probably damaging 0.98
R1985:Dscc1 UTSW 15 55080176 splice site probably benign
R2418:Dscc1 UTSW 15 55083424 nonsense probably null
R2419:Dscc1 UTSW 15 55083424 nonsense probably null
R3955:Dscc1 UTSW 15 55083553 missense probably benign 0.05
R4773:Dscc1 UTSW 15 55080258 missense probably benign 0.01
R5611:Dscc1 UTSW 15 55082173 missense probably benign 0.23
R6484:Dscc1 UTSW 15 55080290 nonsense probably null
R7562:Dscc1 UTSW 15 55084185 missense probably benign 0.15
R7662:Dscc1 UTSW 15 55076165 missense possibly damaging 0.95
R7924:Dscc1 UTSW 15 55082176 missense probably benign 0.03
R9263:Dscc1 UTSW 15 55084109 missense probably damaging 1.00
Z1088:Dscc1 UTSW 15 55080317 missense possibly damaging 0.70
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ctaaacaatacaaacccaggaaaac -3'
Posted On 2013-07-30