Incidental Mutation 'R8162:Ash1l'
ID633561
Institutional Source Beutler Lab
Gene Symbol Ash1l
Ensembl Gene ENSMUSG00000028053
Gene NameASH1 like histone lysine methyltransferase
Synonymschromatin remodeling factor, E430018P19Rik, KMT2H, 8030453L17Rik
MMRRC Submission
Accession Numbers

Genbank: NM_138679; MGI: 2183158

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8162 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location88950622-89079375 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 89070246 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 2661 (M2661R)
Ref Sequence ENSEMBL: ENSMUSP00000088451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090933] [ENSMUST00000186583]
Predicted Effect probably damaging
Transcript: ENSMUST00000090933
AA Change: M2661R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000088451
Gene: ENSMUSG00000028053
AA Change: M2661R

DomainStartEndE-ValueType
low complexity region 36 46 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
internal_repeat_1 238 306 6.88e-12 PROSPERO
internal_repeat_1 306 406 6.88e-12 PROSPERO
low complexity region 552 571 N/A INTRINSIC
low complexity region 706 717 N/A INTRINSIC
low complexity region 745 753 N/A INTRINSIC
low complexity region 777 791 N/A INTRINSIC
AT_hook 823 835 3.06e2 SMART
low complexity region 859 873 N/A INTRINSIC
AT_hook 885 897 9.15e0 SMART
low complexity region 938 948 N/A INTRINSIC
low complexity region 1086 1105 N/A INTRINSIC
low complexity region 1107 1121 N/A INTRINSIC
low complexity region 1159 1173 N/A INTRINSIC
low complexity region 1262 1273 N/A INTRINSIC
low complexity region 1288 1301 N/A INTRINSIC
AT_hook 1345 1357 3.09e-1 SMART
low complexity region 1377 1388 N/A INTRINSIC
low complexity region 1395 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
low complexity region 1678 1692 N/A INTRINSIC
AT_hook 1843 1855 1.03e1 SMART
low complexity region 1971 1983 N/A INTRINSIC
AWS 2081 2133 3.95e-26 SMART
SET 2135 2257 8.04e-45 SMART
PostSET 2259 2275 6.38e-2 SMART
low complexity region 2296 2316 N/A INTRINSIC
BROMO 2431 2541 8.29e-23 SMART
low complexity region 2549 2563 N/A INTRINSIC
PHD 2576 2618 8.25e-6 SMART
BAH 2650 2787 1.18e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186583
AA Change: M2661R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140251
Gene: ENSMUSG00000028053
AA Change: M2661R

DomainStartEndE-ValueType
low complexity region 36 46 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
internal_repeat_1 238 306 6.88e-12 PROSPERO
internal_repeat_1 306 406 6.88e-12 PROSPERO
low complexity region 552 571 N/A INTRINSIC
low complexity region 706 717 N/A INTRINSIC
low complexity region 745 753 N/A INTRINSIC
low complexity region 777 791 N/A INTRINSIC
AT_hook 823 835 3.06e2 SMART
low complexity region 859 873 N/A INTRINSIC
AT_hook 885 897 9.15e0 SMART
low complexity region 938 948 N/A INTRINSIC
low complexity region 1086 1105 N/A INTRINSIC
low complexity region 1107 1121 N/A INTRINSIC
low complexity region 1159 1173 N/A INTRINSIC
low complexity region 1262 1273 N/A INTRINSIC
low complexity region 1288 1301 N/A INTRINSIC
AT_hook 1345 1357 3.09e-1 SMART
low complexity region 1377 1388 N/A INTRINSIC
low complexity region 1395 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
low complexity region 1678 1692 N/A INTRINSIC
AT_hook 1843 1855 1.03e1 SMART
low complexity region 1971 1983 N/A INTRINSIC
AWS 2081 2133 3.95e-26 SMART
SET 2135 2257 8.04e-45 SMART
PostSET 2259 2275 6.38e-2 SMART
low complexity region 2296 2316 N/A INTRINSIC
BROMO 2431 2541 8.29e-23 SMART
low complexity region 2549 2563 N/A INTRINSIC
PHD 2576 2618 8.25e-6 SMART
BAH 2650 2787 1.18e-23 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the trithorax group of transcriptional activators. The protein contains four AT hooks, a SET domain, a PHD-finger motif, and a bromodomain. It is localized to many small speckles in the nucleus, and also to cell-cell tight junctions. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a transposon-induced allele are more susceptible to endotoxin shock, sepsis, and autoimmune disease. Homozygotes for a hypomorphic allele show reduced growth and postnatal lethality; surviving adults lack Meibomian glands and show vertebral, reproductive organ, and fertility defects. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7b T A 15: 77,423,230 Q355L probably benign Het
Asb14 A T 14: 26,911,988 Q383H probably benign Het
Cacna1e G T 1: 154,701,567 probably null Het
Ccdc40 G T 11: 119,260,044 probably null Het
Cd27 T A 6: 125,233,225 probably null Het
Ces3b T C 8: 105,090,753 L371S possibly damaging Het
Clec4a2 T A 6: 123,140,752 Y210N probably damaging Het
Cpeb2 A T 5: 43,237,338 H553L Het
Cpne8 T C 15: 90,619,678 I95V probably benign Het
D630039A03Rik T C 4: 57,910,525 T96A probably benign Het
Dand5 C A 8: 84,816,518 G110C probably damaging Het
Erich3 C T 3: 154,764,573 T1554M unknown Het
Evi5l T C 8: 4,191,300 S278P probably damaging Het
Fam208b G T 13: 3,599,691 T36N probably damaging Het
Farp2 C A 1: 93,620,603 H1003Q probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gm13741 A C 2: 87,656,102 M273R possibly damaging Het
Gm28363 T A 1: 117,698,911 D26E unknown Het
Gm8674 A T 13: 49,900,371 D700E noncoding transcript Het
Gm9008 C A 6: 76,496,575 A353S probably benign Het
Gtf3c4 G A 2: 28,834,581 Q380* probably null Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Il1a A T 2: 129,306,557 S78T possibly damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Mcc T C 18: 44,449,441 probably null Het
Met A G 6: 17,547,062 D898G probably damaging Het
Mogs T C 6: 83,115,882 V101A probably damaging Het
Mrgpra4 A T 7: 47,981,473 Y127N probably damaging Het
Ms4a18 A G 19: 11,013,707 S8P probably benign Het
Muc4 A T 16: 32,750,379 T148S unknown Het
Nutm1 G A 2: 112,248,472 L1033F probably benign Het
Ocstamp G T 2: 165,397,867 A133D probably damaging Het
Olfr146 T A 9: 39,018,953 D196V probably benign Het
Olfr374 T G 8: 72,110,409 V281G noncoding transcript Het
Olfr466 G A 13: 65,152,920 R232Q probably damaging Het
Olfr487 T C 7: 108,211,788 H247R probably damaging Het
Papd4 A G 13: 93,167,924 probably null Het
Phf12 C A 11: 78,024,825 P46Q probably damaging Het
Prf1 A G 10: 61,302,970 T236A probably damaging Het
Ptcd3 A G 6: 71,907,814 V47A probably benign Het
Rapgef1 A T 2: 29,735,999 N1071Y probably damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Tango6 C T 8: 106,683,250 P33L possibly damaging Het
Tbc1d2b C T 9: 90,207,884 R864H probably damaging Het
Trav10n A T 14: 53,122,472 I69L probably benign Het
Tsks A G 7: 44,953,872 Q366R probably damaging Het
Vcan G T 13: 89,704,987 S618* probably null Het
Vwf T A 6: 125,645,836 probably null Het
Zfp827 T A 8: 79,060,577 L124* probably null Het
Other mutations in Ash1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Ash1l APN 3 88981712 missense probably benign 0.19
IGL00819:Ash1l APN 3 89007736 missense possibly damaging 0.68
IGL00939:Ash1l APN 3 89035236 missense probably damaging 0.99
IGL01064:Ash1l APN 3 89072484 missense probably damaging 1.00
IGL01066:Ash1l APN 3 88984635 missense probably damaging 1.00
IGL01087:Ash1l APN 3 89063902 missense probably damaging 1.00
IGL01293:Ash1l APN 3 88983529 missense probably benign 0.01
IGL01541:Ash1l APN 3 89066265 missense probably damaging 1.00
IGL01863:Ash1l APN 3 88985506 nonsense probably null
IGL02326:Ash1l APN 3 88966057 missense probably benign 0.00
IGL02407:Ash1l APN 3 89072548 missense probably damaging 1.00
IGL02419:Ash1l APN 3 88985565 missense probably benign 0.00
IGL02422:Ash1l APN 3 89069079 critical splice donor site probably null
IGL02494:Ash1l APN 3 89066218 nonsense probably null
IGL02727:Ash1l APN 3 89023037 missense probably benign
IGL02732:Ash1l APN 3 88966228 missense probably damaging 1.00
IGL02817:Ash1l APN 3 88984801 missense probably damaging 1.00
IGL02887:Ash1l APN 3 88984181 missense probably benign 0.11
IGL03224:Ash1l APN 3 89035268 splice site probably benign
IGL03253:Ash1l APN 3 88984674 missense probably damaging 1.00
IGL03327:Ash1l APN 3 89023083 missense probably benign 0.02
IGL03398:Ash1l APN 3 89007220 missense probably benign 0.01
3-1:Ash1l UTSW 3 88966326 missense probably benign
BB008:Ash1l UTSW 3 89043541 missense probably damaging 1.00
BB018:Ash1l UTSW 3 89043541 missense probably damaging 1.00
R0068:Ash1l UTSW 3 89007317 missense probably benign 0.17
R0068:Ash1l UTSW 3 89007317 missense probably benign 0.17
R0239:Ash1l UTSW 3 89067222 missense possibly damaging 0.49
R0239:Ash1l UTSW 3 89067222 missense possibly damaging 0.49
R0395:Ash1l UTSW 3 89058589 missense probably damaging 1.00
R0477:Ash1l UTSW 3 88983459 missense probably benign 0.41
R0528:Ash1l UTSW 3 88982277 missense probably benign
R0543:Ash1l UTSW 3 89063778 splice site probably null
R0855:Ash1l UTSW 3 89054454 missense possibly damaging 0.82
R1147:Ash1l UTSW 3 88984887 missense possibly damaging 0.72
R1147:Ash1l UTSW 3 88984887 missense possibly damaging 0.72
R1163:Ash1l UTSW 3 89035263 critical splice donor site probably null
R1196:Ash1l UTSW 3 88983316 missense probably damaging 0.99
R1419:Ash1l UTSW 3 88984897 missense probably damaging 0.99
R1445:Ash1l UTSW 3 89007352 missense probably benign 0.02
R1466:Ash1l UTSW 3 89052065 missense probably damaging 1.00
R1466:Ash1l UTSW 3 89052065 missense probably damaging 1.00
R1480:Ash1l UTSW 3 88985052 missense probably damaging 1.00
R1506:Ash1l UTSW 3 89058499 missense probably damaging 0.99
R1537:Ash1l UTSW 3 89072476 missense probably damaging 0.99
R1584:Ash1l UTSW 3 89052065 missense probably damaging 1.00
R1669:Ash1l UTSW 3 89067242 critical splice donor site probably null
R1713:Ash1l UTSW 3 89076224 missense probably damaging 1.00
R1780:Ash1l UTSW 3 88965984 missense probably benign
R1793:Ash1l UTSW 3 89070309 missense probably damaging 1.00
R1881:Ash1l UTSW 3 88981555 missense probably benign 0.00
R1909:Ash1l UTSW 3 88984528 missense probably benign 0.29
R1938:Ash1l UTSW 3 88984422 missense probably damaging 0.98
R2035:Ash1l UTSW 3 89066317 missense probably benign 0.00
R2070:Ash1l UTSW 3 88966203 missense probably damaging 1.00
R2071:Ash1l UTSW 3 88966203 missense probably damaging 1.00
R2114:Ash1l UTSW 3 88983264 missense probably benign 0.00
R2116:Ash1l UTSW 3 88983264 missense probably benign 0.00
R2118:Ash1l UTSW 3 88985295 missense possibly damaging 0.80
R2143:Ash1l UTSW 3 88985419 missense probably benign 0.09
R2164:Ash1l UTSW 3 88985419 missense probably benign 0.09
R2210:Ash1l UTSW 3 89066298 missense probably damaging 1.00
R2247:Ash1l UTSW 3 89007367 missense possibly damaging 0.77
R2303:Ash1l UTSW 3 89026426 missense probably damaging 1.00
R2860:Ash1l UTSW 3 89054478 missense probably damaging 1.00
R2861:Ash1l UTSW 3 89054478 missense probably damaging 1.00
R3104:Ash1l UTSW 3 89054386 missense probably damaging 1.00
R4133:Ash1l UTSW 3 88982260 missense probably benign 0.00
R4164:Ash1l UTSW 3 88981966 missense probably damaging 0.97
R4270:Ash1l UTSW 3 88982040 missense probably benign 0.26
R4271:Ash1l UTSW 3 88982040 missense probably benign 0.26
R4287:Ash1l UTSW 3 89066415 missense probably damaging 0.99
R4409:Ash1l UTSW 3 89007199 missense probably damaging 0.99
R4459:Ash1l UTSW 3 88966234 missense probably damaging 0.99
R4487:Ash1l UTSW 3 88985315 missense possibly damaging 0.65
R4674:Ash1l UTSW 3 89072476 missense possibly damaging 0.80
R4739:Ash1l UTSW 3 88982845 missense probably benign 0.19
R4927:Ash1l UTSW 3 88985334 missense probably damaging 1.00
R5000:Ash1l UTSW 3 89058634 missense probably damaging 1.00
R5016:Ash1l UTSW 3 88982323 missense probably damaging 1.00
R5055:Ash1l UTSW 3 89023212 critical splice donor site probably null
R5081:Ash1l UTSW 3 88984717 missense probably damaging 1.00
R5082:Ash1l UTSW 3 88966234 missense probably damaging 0.99
R5090:Ash1l UTSW 3 89052877 missense probably damaging 1.00
R5113:Ash1l UTSW 3 89066275 missense probably damaging 0.99
R5408:Ash1l UTSW 3 88982394 missense probably damaging 1.00
R5452:Ash1l UTSW 3 88984876 missense possibly damaging 0.93
R5487:Ash1l UTSW 3 88981426 missense probably benign 0.17
R5610:Ash1l UTSW 3 89023185 missense probably damaging 1.00
R5624:Ash1l UTSW 3 88985609 missense probably damaging 1.00
R5682:Ash1l UTSW 3 89007607 missense probably damaging 0.99
R5712:Ash1l UTSW 3 89051990 missense probably damaging 0.99
R5719:Ash1l UTSW 3 89054498 missense possibly damaging 0.83
R5719:Ash1l UTSW 3 89058626 missense probably damaging 1.00
R5839:Ash1l UTSW 3 88983351 missense probably damaging 0.99
R5859:Ash1l UTSW 3 89068993 missense probably damaging 1.00
R5877:Ash1l UTSW 3 88981584 missense probably benign 0.00
R5940:Ash1l UTSW 3 88984036 missense probably damaging 0.96
R6026:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6027:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6029:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6033:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6033:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6034:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6034:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6035:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6035:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6089:Ash1l UTSW 3 89053143 nonsense probably null
R6110:Ash1l UTSW 3 88985129 missense probably damaging 1.00
R6168:Ash1l UTSW 3 89052773 nonsense probably null
R6200:Ash1l UTSW 3 89070527 missense probably damaging 1.00
R6290:Ash1l UTSW 3 88982761 nonsense probably null
R6331:Ash1l UTSW 3 89007865 missense probably benign 0.00
R6425:Ash1l UTSW 3 88983780 missense probably damaging 0.99
R6540:Ash1l UTSW 3 88985061 missense probably damaging 1.00
R6568:Ash1l UTSW 3 89052037 missense probably benign 0.09
R6828:Ash1l UTSW 3 89076113 missense probably benign 0.00
R6843:Ash1l UTSW 3 88985388 missense probably damaging 1.00
R6894:Ash1l UTSW 3 88982991 missense probably benign 0.00
R6976:Ash1l UTSW 3 88981657 missense possibly damaging 0.77
R7038:Ash1l UTSW 3 88982671 missense probably benign 0.00
R7073:Ash1l UTSW 3 88985340 missense probably damaging 1.00
R7133:Ash1l UTSW 3 88983457 frame shift probably null
R7150:Ash1l UTSW 3 89077074 missense probably damaging 1.00
R7205:Ash1l UTSW 3 88965952 missense probably benign 0.00
R7254:Ash1l UTSW 3 89070509 missense probably damaging 1.00
R7272:Ash1l UTSW 3 89054634 splice site probably null
R7288:Ash1l UTSW 3 88965892 start gained probably benign
R7319:Ash1l UTSW 3 88981387 missense probably benign 0.19
R7341:Ash1l UTSW 3 88981759 missense possibly damaging 0.93
R7342:Ash1l UTSW 3 88965997 missense possibly damaging 0.94
R7454:Ash1l UTSW 3 88983865 missense probably benign 0.16
R7677:Ash1l UTSW 3 89043193 missense probably damaging 1.00
R7822:Ash1l UTSW 3 89007264 missense probably benign
R7857:Ash1l UTSW 3 88984309 nonsense probably null
R7889:Ash1l UTSW 3 88966038 missense probably benign 0.00
R7898:Ash1l UTSW 3 88983625 missense possibly damaging 0.54
R7931:Ash1l UTSW 3 89043541 missense probably damaging 1.00
R7937:Ash1l UTSW 3 89070317 nonsense probably null
R7973:Ash1l UTSW 3 89052857 missense probably benign
R8119:Ash1l UTSW 3 89035427 missense probably damaging 1.00
R8157:Ash1l UTSW 3 89063707 critical splice donor site probably null
R8194:Ash1l UTSW 3 89052755 missense probably damaging 1.00
R8306:Ash1l UTSW 3 88965952 missense probably benign 0.00
X0017:Ash1l UTSW 3 88984585 missense probably benign 0.45
X0019:Ash1l UTSW 3 89070556 missense probably damaging 1.00
X0021:Ash1l UTSW 3 88983204 missense probably benign 0.10
Z1088:Ash1l UTSW 3 88982709 missense probably benign 0.00
Z1176:Ash1l UTSW 3 89043217 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATAGTTGTCACAATGCTGGC -3'
(R):5'- GCAACTCTACCTCAGTGCAC -3'

Sequencing Primer
(F):5'- GTCACAATGCTGGCTTTATTTTC -3'
(R):5'- ACCTCAGTGCACGCTCTG -3'
Posted On2020-07-13