Incidental Mutation 'R8162:D630039A03Rik'
ID633563
Institutional Source Beutler Lab
Gene Symbol D630039A03Rik
Ensembl Gene ENSMUSG00000052117
Gene NameRIKEN cDNA D630039A03 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R8162 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location57908483-57916297 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57910525 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 96 (T96A)
Ref Sequence ENSEMBL: ENSMUSP00000068932 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000063816
AA Change: T96A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7b T A 15: 77,423,230 Q355L probably benign Het
Asb14 A T 14: 26,911,988 Q383H probably benign Het
Ash1l T G 3: 89,070,246 M2661R probably damaging Het
Cacna1e G T 1: 154,701,567 probably null Het
Ccdc40 G T 11: 119,260,044 probably null Het
Cd27 T A 6: 125,233,225 probably null Het
Ces3b T C 8: 105,090,753 L371S possibly damaging Het
Clec4a2 T A 6: 123,140,752 Y210N probably damaging Het
Cpeb2 A T 5: 43,237,338 H553L Het
Cpne8 T C 15: 90,619,678 I95V probably benign Het
Dand5 C A 8: 84,816,518 G110C probably damaging Het
Erich3 C T 3: 154,764,573 T1554M unknown Het
Evi5l T C 8: 4,191,300 S278P probably damaging Het
Fam208b G T 13: 3,599,691 T36N probably damaging Het
Farp2 C A 1: 93,620,603 H1003Q probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gm13741 A C 2: 87,656,102 M273R possibly damaging Het
Gm28363 T A 1: 117,698,911 D26E unknown Het
Gm8674 A T 13: 49,900,371 D700E noncoding transcript Het
Gm9008 C A 6: 76,496,575 A353S probably benign Het
Gtf3c4 G A 2: 28,834,581 Q380* probably null Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Il1a A T 2: 129,306,557 S78T possibly damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Mcc T C 18: 44,449,441 probably null Het
Met A G 6: 17,547,062 D898G probably damaging Het
Mogs T C 6: 83,115,882 V101A probably damaging Het
Mrgpra4 A T 7: 47,981,473 Y127N probably damaging Het
Ms4a18 A G 19: 11,013,707 S8P probably benign Het
Muc4 A T 16: 32,750,379 T148S unknown Het
Nutm1 G A 2: 112,248,472 L1033F probably benign Het
Ocstamp G T 2: 165,397,867 A133D probably damaging Het
Olfr146 T A 9: 39,018,953 D196V probably benign Het
Olfr374 T G 8: 72,110,409 V281G noncoding transcript Het
Olfr466 G A 13: 65,152,920 R232Q probably damaging Het
Olfr487 T C 7: 108,211,788 H247R probably damaging Het
Papd4 A G 13: 93,167,924 probably null Het
Phf12 C A 11: 78,024,825 P46Q probably damaging Het
Prf1 A G 10: 61,302,970 T236A probably damaging Het
Ptcd3 A G 6: 71,907,814 V47A probably benign Het
Rapgef1 A T 2: 29,735,999 N1071Y probably damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Tango6 C T 8: 106,683,250 P33L possibly damaging Het
Tbc1d2b C T 9: 90,207,884 R864H probably damaging Het
Trav10n A T 14: 53,122,472 I69L probably benign Het
Tsks A G 7: 44,953,872 Q366R probably damaging Het
Vcan G T 13: 89,704,987 S618* probably null Het
Vwf T A 6: 125,645,836 probably null Het
Zfp827 T A 8: 79,060,577 L124* probably null Het
Other mutations in D630039A03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01666:D630039A03Rik APN 4 57910570 missense possibly damaging 0.86
IGL02071:D630039A03Rik APN 4 57910309 missense possibly damaging 0.94
IGL03338:D630039A03Rik APN 4 57910509 missense probably benign 0.12
R1828:D630039A03Rik UTSW 4 57910240 missense probably benign 0.02
R2883:D630039A03Rik UTSW 4 57910560 missense probably damaging 1.00
R3874:D630039A03Rik UTSW 4 57910606 missense probably benign 0.27
R3875:D630039A03Rik UTSW 4 57910606 missense probably benign 0.27
R4776:D630039A03Rik UTSW 4 57910452 missense possibly damaging 0.72
R5152:D630039A03Rik UTSW 4 57910434 missense probably damaging 1.00
R7003:D630039A03Rik UTSW 4 57910521 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAACATCAGTGTCTCCCTCG -3'
(R):5'- TACTCTGGGTATCTGGTCCC -3'

Sequencing Primer
(F):5'- CCTCGGGTGAGAACCTTGGTTC -3'
(R):5'- CCCTTGGCATTCAGGGTCTG -3'
Posted On2020-07-13