Incidental Mutation 'R8162:Cpeb2'
ID633564
Institutional Source Beutler Lab
Gene Symbol Cpeb2
Ensembl Gene ENSMUSG00000039782
Gene Namecytoplasmic polyadenylation element binding protein 2
SynonymsA630055H10Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.307) question?
Stock #R8162 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location43233170-43289724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43237338 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 553 (H553L)
Ref Sequence ENSEMBL: ENSMUSP00000130921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114066] [ENSMUST00000166713] [ENSMUST00000169035]
Predicted Effect
SMART Domains Protein: ENSMUSP00000109699
Gene: ENSMUSG00000039782
AA Change: H387L

DomainStartEndE-ValueType
low complexity region 3 41 N/A INTRINSIC
RRM 265 337 1.5e-4 SMART
RRM 373 446 1.86e-2 SMART
PDB:2M13|A 447 512 1e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000114066
AA Change: H28L

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000109700
Gene: ENSMUSG00000039782
AA Change: H28L

DomainStartEndE-ValueType
low complexity region 3 41 N/A INTRINSIC
low complexity region 222 232 N/A INTRINSIC
RRM 273 345 1.5e-4 SMART
RRM 381 454 1.86e-2 SMART
PDB:2M13|A 455 520 1e-6 PDB
Predicted Effect
SMART Domains Protein: ENSMUSP00000130921
Gene: ENSMUSG00000039782
AA Change: H553L

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 30 53 N/A INTRINSIC
low complexity region 56 79 N/A INTRINSIC
low complexity region 142 156 N/A INTRINSIC
low complexity region 161 177 N/A INTRINSIC
low complexity region 178 199 N/A INTRINSIC
low complexity region 204 215 N/A INTRINSIC
low complexity region 245 276 N/A INTRINSIC
low complexity region 279 293 N/A INTRINSIC
low complexity region 342 369 N/A INTRINSIC
low complexity region 375 433 N/A INTRINSIC
low complexity region 451 460 N/A INTRINSIC
low complexity region 471 481 N/A INTRINSIC
low complexity region 489 534 N/A INTRINSIC
RRM 758 830 1.5e-4 SMART
RRM 866 939 1.86e-2 SMART
PDB:2M13|A 940 1005 2e-6 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000169035
AA Change: H553L

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125857
Gene: ENSMUSG00000039782
AA Change: H553L

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 30 53 N/A INTRINSIC
low complexity region 56 79 N/A INTRINSIC
low complexity region 142 156 N/A INTRINSIC
low complexity region 161 177 N/A INTRINSIC
low complexity region 178 199 N/A INTRINSIC
low complexity region 204 215 N/A INTRINSIC
low complexity region 245 276 N/A INTRINSIC
low complexity region 279 293 N/A INTRINSIC
low complexity region 342 369 N/A INTRINSIC
low complexity region 375 433 N/A INTRINSIC
low complexity region 451 460 N/A INTRINSIC
low complexity region 471 481 N/A INTRINSIC
low complexity region 489 534 N/A INTRINSIC
low complexity region 685 695 N/A INTRINSIC
RRM 736 808 1.5e-4 SMART
RRM 844 917 1.86e-2 SMART
PDB:2M13|A 918 983 2e-6 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to cytoplasmic polyadenylation element binding protein (CPEB), an mRNA-binding protein that regulates cytoplasmic polyadenylation of mRNA as a trans factor in oogenesis and spermatogenesis. Studies of the similar gene in mice suggested a possible role of this protein in transcriptionally inactive haploid spermatids. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early postnatal lethality, decreased heart rate, and increased parasympathetic signaling leading to increased pulmonary acetylcholine level, bronchoconstriction, severe apnea, and abnormal breathing patterns. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7b T A 15: 77,423,230 Q355L probably benign Het
Asb14 A T 14: 26,911,988 Q383H probably benign Het
Ash1l T G 3: 89,070,246 M2661R probably damaging Het
Cacna1e G T 1: 154,701,567 probably null Het
Ccdc40 G T 11: 119,260,044 probably null Het
Cd27 T A 6: 125,233,225 probably null Het
Ces3b T C 8: 105,090,753 L371S possibly damaging Het
Clec4a2 T A 6: 123,140,752 Y210N probably damaging Het
Cpne8 T C 15: 90,619,678 I95V probably benign Het
D630039A03Rik T C 4: 57,910,525 T96A probably benign Het
Dand5 C A 8: 84,816,518 G110C probably damaging Het
Erich3 C T 3: 154,764,573 T1554M unknown Het
Evi5l T C 8: 4,191,300 S278P probably damaging Het
Fam208b G T 13: 3,599,691 T36N probably damaging Het
Farp2 C A 1: 93,620,603 H1003Q probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gm13741 A C 2: 87,656,102 M273R possibly damaging Het
Gm28363 T A 1: 117,698,911 D26E unknown Het
Gm8674 A T 13: 49,900,371 D700E noncoding transcript Het
Gm9008 C A 6: 76,496,575 A353S probably benign Het
Gtf3c4 G A 2: 28,834,581 Q380* probably null Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Il1a A T 2: 129,306,557 S78T possibly damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Mcc T C 18: 44,449,441 probably null Het
Met A G 6: 17,547,062 D898G probably damaging Het
Mogs T C 6: 83,115,882 V101A probably damaging Het
Mrgpra4 A T 7: 47,981,473 Y127N probably damaging Het
Ms4a18 A G 19: 11,013,707 S8P probably benign Het
Muc4 A T 16: 32,750,379 T148S unknown Het
Nutm1 G A 2: 112,248,472 L1033F probably benign Het
Ocstamp G T 2: 165,397,867 A133D probably damaging Het
Olfr146 T A 9: 39,018,953 D196V probably benign Het
Olfr374 T G 8: 72,110,409 V281G noncoding transcript Het
Olfr466 G A 13: 65,152,920 R232Q probably damaging Het
Olfr487 T C 7: 108,211,788 H247R probably damaging Het
Papd4 A G 13: 93,167,924 probably null Het
Phf12 C A 11: 78,024,825 P46Q probably damaging Het
Prf1 A G 10: 61,302,970 T236A probably damaging Het
Ptcd3 A G 6: 71,907,814 V47A probably benign Het
Rapgef1 A T 2: 29,735,999 N1071Y probably damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Tango6 C T 8: 106,683,250 P33L possibly damaging Het
Tbc1d2b C T 9: 90,207,884 R864H probably damaging Het
Trav10n A T 14: 53,122,472 I69L probably benign Het
Tsks A G 7: 44,953,872 Q366R probably damaging Het
Vcan G T 13: 89,704,987 S618* probably null Het
Vwf T A 6: 125,645,836 probably null Het
Zfp827 T A 8: 79,060,577 L124* probably null Het
Other mutations in Cpeb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Cpeb2 APN 5 43285831 missense probably damaging 0.98
IGL00771:Cpeb2 APN 5 43237547 missense possibly damaging 0.94
IGL00797:Cpeb2 APN 5 43281447 missense probably damaging 1.00
IGL01604:Cpeb2 APN 5 43278695 critical splice donor site probably null
IGL01632:Cpeb2 APN 5 43237422 missense probably benign 0.25
IGL03137:Cpeb2 APN 5 43261724 splice site probably benign
R0125:Cpeb2 UTSW 5 43238400 intron probably benign
R0200:Cpeb2 UTSW 5 43261776 missense possibly damaging 0.57
R0453:Cpeb2 UTSW 5 43285713 splice site probably benign
R1411:Cpeb2 UTSW 5 43233770 unclassified probably benign
R1542:Cpeb2 UTSW 5 43285875 missense probably damaging 1.00
R1563:Cpeb2 UTSW 5 43285737 missense probably damaging 1.00
R1573:Cpeb2 UTSW 5 43283930 splice site probably benign
R1703:Cpeb2 UTSW 5 43233838 unclassified probably benign
R1899:Cpeb2 UTSW 5 43277587 missense probably damaging 1.00
R1942:Cpeb2 UTSW 5 43235253 intron probably benign
R3429:Cpeb2 UTSW 5 43281230 critical splice donor site probably null
R3610:Cpeb2 UTSW 5 43285933 missense probably damaging 0.98
R3848:Cpeb2 UTSW 5 43237445 missense probably damaging 0.97
R4005:Cpeb2 UTSW 5 43238412 intron probably benign
R4306:Cpeb2 UTSW 5 43235235 intron probably benign
R4667:Cpeb2 UTSW 5 43233892 unclassified probably benign
R4754:Cpeb2 UTSW 5 43285857 missense possibly damaging 0.93
R4821:Cpeb2 UTSW 5 43233474 unclassified probably benign
R4906:Cpeb2 UTSW 5 43244662 missense possibly damaging 0.50
R5237:Cpeb2 UTSW 5 43285756 missense probably damaging 0.99
R6693:Cpeb2 UTSW 5 43285912 missense probably damaging 1.00
R7473:Cpeb2 UTSW 5 43277505 missense
R7825:Cpeb2 UTSW 5 43237539 missense probably damaging 1.00
R8138:Cpeb2 UTSW 5 43235009 missense
Z1176:Cpeb2 UTSW 5 43234717 missense
Predicted Primers PCR Primer
(F):5'- GGGTGAAAACTTCCCTAACTCG -3'
(R):5'- TGATGGAGTAGAGCGAGTGAATTTC -3'

Sequencing Primer
(F):5'- AGCAAGATGGGAAGATTTCTTTTTG -3'
(R):5'- CGGTGGTGCTATAACATTACCCG -3'
Posted On2020-07-13