Incidental Mutation 'R8162:Met'
ID633566
Institutional Source Beutler Lab
Gene Symbol Met
Ensembl Gene ENSMUSG00000009376
Gene Namemet proto-oncogene
SynonymsPar4, HGF receptor, c-Met
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8162 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location17463800-17573980 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17547062 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 898 (D898G)
Ref Sequence ENSEMBL: ENSMUSP00000079324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080469] [ENSMUST00000115442] [ENSMUST00000115443]
Predicted Effect probably damaging
Transcript: ENSMUST00000080469
AA Change: D898G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079324
Gene: ENSMUSG00000009376
AA Change: D898G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 52 495 4.5e-134 SMART
PSI 518 561 1.18e-9 SMART
IPT 561 654 9.43e-15 SMART
IPT 655 738 4.16e-25 SMART
IPT 740 835 3.38e-16 SMART
IPT 837 933 4.08e-10 SMART
TyrKc 1076 1335 7.65e-134 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115442
AA Change: D898G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111102
Gene: ENSMUSG00000009376
AA Change: D898G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 52 495 4.5e-134 SMART
PSI 518 561 1.18e-9 SMART
IPT 561 654 9.43e-15 SMART
IPT 655 738 4.16e-25 SMART
IPT 740 835 3.38e-16 SMART
IPT 837 933 4.08e-10 SMART
TyrKc 1076 1335 7.65e-134 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115443
AA Change: D898G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111103
Gene: ENSMUSG00000009376
AA Change: D898G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 52 495 4.5e-134 SMART
PSI 518 561 1.18e-9 SMART
IPT 561 654 9.43e-15 SMART
IPT 655 738 4.16e-25 SMART
IPT 740 835 3.38e-16 SMART
IPT 837 933 4.08e-10 SMART
TyrKc 1076 1335 7.65e-134 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000121923
Gene: ENSMUSG00000009376
AA Change: D30G

DomainStartEndE-ValueType
Blast:IPT 2 64 1e-37 BLAST
low complexity region 65 83 N/A INTRINSIC
PDB:3VW8|A 108 157 5e-23 PDB
Predicted Effect
SMART Domains Protein: ENSMUSP00000118755
Gene: ENSMUSG00000009376
AA Change: D178G

DomainStartEndE-ValueType
IPT 21 116 3.38e-16 SMART
IPT 118 202 4.34e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor tyrosine kinase family of proteins and the product of the proto-oncogene MET. The encoded preproprotein is proteolytically processed to generate alpha and beta subunits that are linked via disulfide bonds to form the mature receptor. Further processing of the beta subunit results in the formation of the M10 peptide, which has been shown to reduce lung fibrosis. Binding of its ligand, hepatocyte growth factor, induces dimerization and activation of the receptor, which plays a role in cellular survival, embryogenesis, and cellular migration and invasion. Mutations in this gene are associated with papillary renal cell carcinoma, hepatocellular carcinoma, and various head and neck cancers. Amplification and overexpression of this gene are also associated with multiple human cancers. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous null mutants exhibit impaired embryonic development resulting in death. Abnormalities observed in various mutant lines include muscle agenesis due to impaired migration of myogenic precursors, defects of motor axon migration, and placental andliver defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7b T A 15: 77,423,230 Q355L probably benign Het
Asb14 A T 14: 26,911,988 Q383H probably benign Het
Ash1l T G 3: 89,070,246 M2661R probably damaging Het
Cacna1e G T 1: 154,701,567 probably null Het
Ccdc40 G T 11: 119,260,044 probably null Het
Cd27 T A 6: 125,233,225 probably null Het
Ces3b T C 8: 105,090,753 L371S possibly damaging Het
Clec4a2 T A 6: 123,140,752 Y210N probably damaging Het
Cpeb2 A T 5: 43,237,338 H553L Het
Cpne8 T C 15: 90,619,678 I95V probably benign Het
D630039A03Rik T C 4: 57,910,525 T96A probably benign Het
Dand5 C A 8: 84,816,518 G110C probably damaging Het
Erich3 C T 3: 154,764,573 T1554M unknown Het
Evi5l T C 8: 4,191,300 S278P probably damaging Het
Fam208b G T 13: 3,599,691 T36N probably damaging Het
Farp2 C A 1: 93,620,603 H1003Q probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gm13741 A C 2: 87,656,102 M273R possibly damaging Het
Gm28363 T A 1: 117,698,911 D26E unknown Het
Gm8674 A T 13: 49,900,371 D700E noncoding transcript Het
Gm9008 C A 6: 76,496,575 A353S probably benign Het
Gtf3c4 G A 2: 28,834,581 Q380* probably null Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Il1a A T 2: 129,306,557 S78T possibly damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Mcc T C 18: 44,449,441 probably null Het
Mogs T C 6: 83,115,882 V101A probably damaging Het
Mrgpra4 A T 7: 47,981,473 Y127N probably damaging Het
Ms4a18 A G 19: 11,013,707 S8P probably benign Het
Muc4 A T 16: 32,750,379 T148S unknown Het
Nutm1 G A 2: 112,248,472 L1033F probably benign Het
Ocstamp G T 2: 165,397,867 A133D probably damaging Het
Olfr146 T A 9: 39,018,953 D196V probably benign Het
Olfr374 T G 8: 72,110,409 V281G noncoding transcript Het
Olfr466 G A 13: 65,152,920 R232Q probably damaging Het
Olfr487 T C 7: 108,211,788 H247R probably damaging Het
Papd4 A G 13: 93,167,924 probably null Het
Phf12 C A 11: 78,024,825 P46Q probably damaging Het
Prf1 A G 10: 61,302,970 T236A probably damaging Het
Ptcd3 A G 6: 71,907,814 V47A probably benign Het
Rapgef1 A T 2: 29,735,999 N1071Y probably damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Tango6 C T 8: 106,683,250 P33L possibly damaging Het
Tbc1d2b C T 9: 90,207,884 R864H probably damaging Het
Trav10n A T 14: 53,122,472 I69L probably benign Het
Tsks A G 7: 44,953,872 Q366R probably damaging Het
Vcan G T 13: 89,704,987 S618* probably null Het
Vwf T A 6: 125,645,836 probably null Het
Zfp827 T A 8: 79,060,577 L124* probably null Het
Other mutations in Met
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00533:Met APN 6 17534937 unclassified probably benign
IGL01066:Met APN 6 17535105 critical splice donor site probably null
IGL01344:Met APN 6 17547032 missense probably benign 0.44
IGL01413:Met APN 6 17558896 splice site probably benign
IGL01608:Met APN 6 17558730 missense probably damaging 1.00
IGL01613:Met APN 6 17540577 missense probably damaging 1.00
IGL01820:Met APN 6 17534231 missense possibly damaging 0.89
IGL01843:Met APN 6 17491701 missense probably damaging 1.00
IGL02014:Met APN 6 17527257 splice site probably benign
IGL02027:Met APN 6 17563727 splice site probably benign
IGL02243:Met APN 6 17549094 missense probably damaging 1.00
IGL02373:Met APN 6 17491529 missense probably damaging 1.00
IGL02616:Met APN 6 17553347 missense probably damaging 1.00
IGL02702:Met APN 6 17534143 missense possibly damaging 0.92
IGL02704:Met APN 6 17491257 missense possibly damaging 0.62
IGL02714:Met APN 6 17491852 nonsense probably null
IGL02936:Met APN 6 17553397 missense probably damaging 1.00
IGL02943:Met APN 6 17535929 missense possibly damaging 0.84
IGL03057:Met APN 6 17558766 missense probably damaging 1.00
IGL03124:Met APN 6 17492078 missense probably benign 0.27
IGL03171:Met APN 6 17562273 splice site probably benign
IGL03266:Met APN 6 17540538 missense possibly damaging 0.61
IGL03285:Met APN 6 17553337 missense probably damaging 0.98
R0453:Met UTSW 6 17534198 missense possibly damaging 0.88
R0543:Met UTSW 6 17491970 missense probably damaging 1.00
R0601:Met UTSW 6 17555632 splice site probably null
R0652:Met UTSW 6 17491710 missense probably benign 0.00
R0941:Met UTSW 6 17491394 missense probably damaging 1.00
R1142:Met UTSW 6 17527183 nonsense probably null
R1553:Met UTSW 6 17491461 missense probably benign 0.01
R1569:Met UTSW 6 17531504 nonsense probably null
R1744:Met UTSW 6 17540646 missense possibly damaging 0.47
R2224:Met UTSW 6 17563722 splice site probably null
R2308:Met UTSW 6 17491742 missense probably benign 0.00
R2369:Met UTSW 6 17531528 missense probably benign 0.04
R2393:Met UTSW 6 17534198 missense probably damaging 0.99
R2419:Met UTSW 6 17535830 splice site probably benign
R2483:Met UTSW 6 17549086 missense probably damaging 1.00
R2511:Met UTSW 6 17491967 missense probably damaging 1.00
R3622:Met UTSW 6 17549086 missense probably damaging 1.00
R3623:Met UTSW 6 17549086 missense probably damaging 1.00
R3624:Met UTSW 6 17549086 missense probably damaging 1.00
R4050:Met UTSW 6 17533984 missense probably benign
R4051:Met UTSW 6 17548729 missense possibly damaging 0.86
R4159:Met UTSW 6 17562272 splice site probably null
R4208:Met UTSW 6 17548729 missense possibly damaging 0.86
R4622:Met UTSW 6 17513384 missense probably benign 0.19
R4672:Met UTSW 6 17571804 missense probably benign 0.33
R4737:Met UTSW 6 17491541 missense probably damaging 1.00
R4738:Met UTSW 6 17491541 missense probably damaging 1.00
R4834:Met UTSW 6 17491413 missense probably damaging 0.97
R4846:Met UTSW 6 17491929 missense probably damaging 0.99
R4855:Met UTSW 6 17558797 missense probably damaging 1.00
R4878:Met UTSW 6 17549059 missense probably damaging 1.00
R4902:Met UTSW 6 17546996 missense probably damaging 1.00
R5208:Met UTSW 6 17526423 nonsense probably null
R5355:Met UTSW 6 17491362 missense probably damaging 1.00
R5415:Met UTSW 6 17527085 missense probably benign 0.01
R5556:Met UTSW 6 17534176 missense probably benign 0.04
R5590:Met UTSW 6 17548782 missense probably benign 0.00
R5683:Met UTSW 6 17571744 missense probably damaging 1.00
R5872:Met UTSW 6 17562198 missense probably damaging 1.00
R5891:Met UTSW 6 17491539 missense probably benign 0.02
R5895:Met UTSW 6 17531582 missense probably benign 0.02
R6063:Met UTSW 6 17491968 missense probably damaging 1.00
R6262:Met UTSW 6 17553404 missense probably benign 0.00
R6362:Met UTSW 6 17558733 missense probably damaging 1.00
R6747:Met UTSW 6 17571467 missense probably damaging 1.00
R6966:Met UTSW 6 17531532 missense possibly damaging 0.65
R6989:Met UTSW 6 17535928 missense possibly damaging 0.67
R6989:Met UTSW 6 17535929 missense probably damaging 1.00
R7017:Met UTSW 6 17491287 nonsense probably null
R7037:Met UTSW 6 17547128 intron probably benign
R7141:Met UTSW 6 17527155 missense probably benign 0.01
R7242:Met UTSW 6 17491317 missense probably damaging 1.00
R7282:Met UTSW 6 17547012 nonsense probably null
R7624:Met UTSW 6 17558835 missense probably damaging 1.00
R7770:Met UTSW 6 17491407 missense possibly damaging 0.79
R7797:Met UTSW 6 17533953 missense probably damaging 1.00
R8082:Met UTSW 6 17492313 missense probably damaging 0.98
R8109:Met UTSW 6 17562237 missense probably damaging 1.00
R8315:Met UTSW 6 17533957 missense probably damaging 0.99
R8325:Met UTSW 6 17571672 missense probably damaging 1.00
R8348:Met UTSW 6 17571800 missense probably benign 0.00
R8354:Met UTSW 6 17491769 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACAGCGTCTGCATTTGTTG -3'
(R):5'- AATCACAGCTAGGAACTGAGGC -3'

Sequencing Primer
(F):5'- GGCTTCCTTCTAGAACTGCCAG -3'
(R):5'- CTGAGGCTGAGCTGATGAGC -3'
Posted On2020-07-13