Incidental Mutation 'R8162:Mogs'
ID633569
Institutional Source Beutler Lab
Gene Symbol Mogs
Ensembl Gene ENSMUSG00000030036
Gene Namemannosyl-oligosaccharide glucosidase
SynonymsGcs1, 1810017N02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8162 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location83115496-83118898 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83115882 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 101 (V101A)
Ref Sequence ENSEMBL: ENSMUSP00000032114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032111] [ENSMUST00000032114] [ENSMUST00000113936] [ENSMUST00000146328] [ENSMUST00000151393] [ENSMUST00000205023]
Predicted Effect probably benign
Transcript: ENSMUST00000032111
SMART Domains Protein: ENSMUSP00000032111
Gene: ENSMUSG00000030035

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 16 31 N/A INTRINSIC
Pfam:WBP-1 71 177 1.4e-50 PFAM
low complexity region 185 200 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000032114
AA Change: V101A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032114
Gene: ENSMUSG00000030036
AA Change: V101A

DomainStartEndE-ValueType
transmembrane domain 40 62 N/A INTRINSIC
low complexity region 74 90 N/A INTRINSIC
Pfam:Glyco_hydro_63N 91 267 1.1e-54 PFAM
Pfam:Glyco_hydro_63 349 832 7e-202 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113936
SMART Domains Protein: ENSMUSP00000109569
Gene: ENSMUSG00000030035

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:WBP-1 36 142 1.2e-50 PFAM
low complexity region 150 165 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123394
Predicted Effect probably benign
Transcript: ENSMUST00000131936
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131939
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145403
Predicted Effect probably benign
Transcript: ENSMUST00000146328
SMART Domains Protein: ENSMUSP00000122900
Gene: ENSMUSG00000030035

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 16 30 N/A INTRINSIC
Pfam:WBP-1 70 176 1.8e-50 PFAM
low complexity region 184 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151393
SMART Domains Protein: ENSMUSP00000145130
Gene: ENSMUSG00000030035

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 16 31 N/A INTRINSIC
Pfam:WBP-1 71 96 4.4e-6 PFAM
low complexity region 102 113 N/A INTRINSIC
low complexity region 171 189 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205023
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the first enzyme in the N-linked oligosaccharide processing pathway. The enzyme cleaves the distal alpha-1,2-linked glucose residue from the Glc(3)-Man(9)-GlcNAc(2) oligosaccharide precursor. This protein is located in the lumen of the endoplasmic reticulum. Defects in this gene are a cause of type IIb congenital disorder of glycosylation (CDGIIb). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7b T A 15: 77,423,230 Q355L probably benign Het
Asb14 A T 14: 26,911,988 Q383H probably benign Het
Ash1l T G 3: 89,070,246 M2661R probably damaging Het
Cacna1e G T 1: 154,701,567 probably null Het
Ccdc40 G T 11: 119,260,044 probably null Het
Cd27 T A 6: 125,233,225 probably null Het
Ces3b T C 8: 105,090,753 L371S possibly damaging Het
Clec4a2 T A 6: 123,140,752 Y210N probably damaging Het
Cpeb2 A T 5: 43,237,338 H553L Het
Cpne8 T C 15: 90,619,678 I95V probably benign Het
D630039A03Rik T C 4: 57,910,525 T96A probably benign Het
Dand5 C A 8: 84,816,518 G110C probably damaging Het
Erich3 C T 3: 154,764,573 T1554M unknown Het
Evi5l T C 8: 4,191,300 S278P probably damaging Het
Fam208b G T 13: 3,599,691 T36N probably damaging Het
Farp2 C A 1: 93,620,603 H1003Q probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gm13741 A C 2: 87,656,102 M273R possibly damaging Het
Gm28363 T A 1: 117,698,911 D26E unknown Het
Gm8674 A T 13: 49,900,371 D700E noncoding transcript Het
Gm9008 C A 6: 76,496,575 A353S probably benign Het
Gtf3c4 G A 2: 28,834,581 Q380* probably null Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Il1a A T 2: 129,306,557 S78T possibly damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Mcc T C 18: 44,449,441 probably null Het
Met A G 6: 17,547,062 D898G probably damaging Het
Mrgpra4 A T 7: 47,981,473 Y127N probably damaging Het
Ms4a18 A G 19: 11,013,707 S8P probably benign Het
Muc4 A T 16: 32,750,379 T148S unknown Het
Nutm1 G A 2: 112,248,472 L1033F probably benign Het
Ocstamp G T 2: 165,397,867 A133D probably damaging Het
Olfr146 T A 9: 39,018,953 D196V probably benign Het
Olfr374 T G 8: 72,110,409 V281G noncoding transcript Het
Olfr466 G A 13: 65,152,920 R232Q probably damaging Het
Olfr487 T C 7: 108,211,788 H247R probably damaging Het
Papd4 A G 13: 93,167,924 probably null Het
Phf12 C A 11: 78,024,825 P46Q probably damaging Het
Prf1 A G 10: 61,302,970 T236A probably damaging Het
Ptcd3 A G 6: 71,907,814 V47A probably benign Het
Rapgef1 A T 2: 29,735,999 N1071Y probably damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Tango6 C T 8: 106,683,250 P33L possibly damaging Het
Tbc1d2b C T 9: 90,207,884 R864H probably damaging Het
Trav10n A T 14: 53,122,472 I69L probably benign Het
Tsks A G 7: 44,953,872 Q366R probably damaging Het
Vcan G T 13: 89,704,987 S618* probably null Het
Vwf T A 6: 125,645,836 probably null Het
Zfp827 T A 8: 79,060,577 L124* probably null Het
Other mutations in Mogs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Mogs APN 6 83118577 missense probably damaging 1.00
IGL02314:Mogs APN 6 83118055 missense probably benign 0.00
IGL02673:Mogs APN 6 83118218 missense probably damaging 1.00
IGL02862:Mogs APN 6 83115890 missense probably damaging 1.00
IGL02984:Mogs UTSW 6 83117315 missense probably benign 0.00
R1547:Mogs UTSW 6 83116025 missense possibly damaging 0.93
R1765:Mogs UTSW 6 83116803 missense probably benign 0.00
R2013:Mogs UTSW 6 83117650 nonsense probably null
R2015:Mogs UTSW 6 83117650 nonsense probably null
R3735:Mogs UTSW 6 83116776 missense possibly damaging 0.88
R3736:Mogs UTSW 6 83116776 missense possibly damaging 0.88
R4279:Mogs UTSW 6 83116067 missense probably damaging 1.00
R4585:Mogs UTSW 6 83118638 missense possibly damaging 0.56
R4586:Mogs UTSW 6 83118638 missense possibly damaging 0.56
R5783:Mogs UTSW 6 83118671 missense probably damaging 1.00
R5825:Mogs UTSW 6 83118212 missense possibly damaging 0.72
R6012:Mogs UTSW 6 83117382 missense probably damaging 1.00
R6753:Mogs UTSW 6 83115882 missense probably damaging 1.00
R7157:Mogs UTSW 6 83118507 missense probably benign 0.01
R7381:Mogs UTSW 6 83115632 missense unknown
R7485:Mogs UTSW 6 83116207 missense probably damaging 1.00
R7575:Mogs UTSW 6 83115835 missense probably damaging 1.00
R7659:Mogs UTSW 6 83116825 critical splice donor site probably null
Z1176:Mogs UTSW 6 83116213 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACGTGAAAGCGGGATTTC -3'
(R):5'- ACACGTGTGCCTGAGCTTAG -3'

Sequencing Primer
(F):5'- AAGGCTCGGTCCGCTGAC -3'
(R):5'- TGAGCTTAGGAGGGGTCCC -3'
Posted On2020-07-13