Incidental Mutation 'R8162:Clec4a2'
ID633570
Institutional Source Beutler Lab
Gene Symbol Clec4a2
Ensembl Gene ENSMUSG00000030148
Gene NameC-type lectin domain family 4, member a2
SynonymsDcir1, dendritic cell immunoreceptor, DCIR, Clecsf6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R8162 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location123106428-123143999 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123140752 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 210 (Y210N)
Ref Sequence ENSEMBL: ENSMUSP00000032248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032248] [ENSMUST00000041779] [ENSMUST00000161365]
Predicted Effect probably damaging
Transcript: ENSMUST00000032248
AA Change: Y210N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032248
Gene: ENSMUSG00000030148
AA Change: Y210N

DomainStartEndE-ValueType
transmembrane domain 45 67 N/A INTRINSIC
CLECT 131 256 1.18e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000041779
AA Change: Y186N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045781
Gene: ENSMUSG00000030148
AA Change: Y186N

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
CLECT 107 232 1.18e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161365
AA Change: Y186N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124615
Gene: ENSMUSG00000030148
AA Change: Y186N

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
CLECT 107 232 1.18e-30 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. The encoded type 2 transmembrane protein may play a role in inflammatory and immune response. Multiple transcript variants encoding distinct isoforms have been identified for this gene. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased IgG2a, IgG2b and IgG3 levels, increased B cell proliferation, enlarged lymph nodes and degeneration of seminiferous tubules. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7b T A 15: 77,423,230 Q355L probably benign Het
Asb14 A T 14: 26,911,988 Q383H probably benign Het
Ash1l T G 3: 89,070,246 M2661R probably damaging Het
Cacna1e G T 1: 154,701,567 probably null Het
Ccdc40 G T 11: 119,260,044 probably null Het
Cd27 T A 6: 125,233,225 probably null Het
Ces3b T C 8: 105,090,753 L371S possibly damaging Het
Cpeb2 A T 5: 43,237,338 H553L Het
Cpne8 T C 15: 90,619,678 I95V probably benign Het
D630039A03Rik T C 4: 57,910,525 T96A probably benign Het
Dand5 C A 8: 84,816,518 G110C probably damaging Het
Erich3 C T 3: 154,764,573 T1554M unknown Het
Evi5l T C 8: 4,191,300 S278P probably damaging Het
Fam208b G T 13: 3,599,691 T36N probably damaging Het
Farp2 C A 1: 93,620,603 H1003Q probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gm13741 A C 2: 87,656,102 M273R possibly damaging Het
Gm28363 T A 1: 117,698,911 D26E unknown Het
Gm8674 A T 13: 49,900,371 D700E noncoding transcript Het
Gm9008 C A 6: 76,496,575 A353S probably benign Het
Gtf3c4 G A 2: 28,834,581 Q380* probably null Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Il1a A T 2: 129,306,557 S78T possibly damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Mcc T C 18: 44,449,441 probably null Het
Met A G 6: 17,547,062 D898G probably damaging Het
Mogs T C 6: 83,115,882 V101A probably damaging Het
Mrgpra4 A T 7: 47,981,473 Y127N probably damaging Het
Ms4a18 A G 19: 11,013,707 S8P probably benign Het
Muc4 A T 16: 32,750,379 T148S unknown Het
Nutm1 G A 2: 112,248,472 L1033F probably benign Het
Ocstamp G T 2: 165,397,867 A133D probably damaging Het
Olfr146 T A 9: 39,018,953 D196V probably benign Het
Olfr374 T G 8: 72,110,409 V281G noncoding transcript Het
Olfr466 G A 13: 65,152,920 R232Q probably damaging Het
Olfr487 T C 7: 108,211,788 H247R probably damaging Het
Papd4 A G 13: 93,167,924 probably null Het
Phf12 C A 11: 78,024,825 P46Q probably damaging Het
Prf1 A G 10: 61,302,970 T236A probably damaging Het
Ptcd3 A G 6: 71,907,814 V47A probably benign Het
Rapgef1 A T 2: 29,735,999 N1071Y probably damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Tango6 C T 8: 106,683,250 P33L possibly damaging Het
Tbc1d2b C T 9: 90,207,884 R864H probably damaging Het
Trav10n A T 14: 53,122,472 I69L probably benign Het
Tsks A G 7: 44,953,872 Q366R probably damaging Het
Vcan G T 13: 89,704,987 S618* probably null Het
Vwf T A 6: 125,645,836 probably null Het
Zfp827 T A 8: 79,060,577 L124* probably null Het
Other mutations in Clec4a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Clec4a2 APN 6 123139078 intron probably benign
IGL01384:Clec4a2 APN 6 123127988 missense probably damaging 1.00
IGL01481:Clec4a2 APN 6 123142500 missense probably benign 0.30
IGL02159:Clec4a2 APN 6 123139326 missense probably benign 0.04
IGL02436:Clec4a2 APN 6 123140678 missense possibly damaging 0.79
IGL03140:Clec4a2 APN 6 123140776 splice site probably benign
R0485:Clec4a2 UTSW 6 123123629 missense probably damaging 0.99
R1852:Clec4a2 UTSW 6 123139125 nonsense probably null
R3431:Clec4a2 UTSW 6 123139411 splice site probably null
R4436:Clec4a2 UTSW 6 123128054 critical splice donor site probably null
R4524:Clec4a2 UTSW 6 123125084 missense probably damaging 1.00
R4736:Clec4a2 UTSW 6 123140663 missense probably damaging 1.00
R4740:Clec4a2 UTSW 6 123140663 missense probably damaging 1.00
R4908:Clec4a2 UTSW 6 123142503 missense probably damaging 1.00
R6516:Clec4a2 UTSW 6 123139406 missense probably damaging 1.00
R7394:Clec4a2 UTSW 6 123139120 missense unknown
R7454:Clec4a2 UTSW 6 123142452 missense probably damaging 0.98
R7644:Clec4a2 UTSW 6 123125015 missense probably benign 0.10
R8053:Clec4a2 UTSW 6 123128039 missense probably benign 0.00
X0024:Clec4a2 UTSW 6 123139081 intron probably benign
X0025:Clec4a2 UTSW 6 123139355 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- CCACGCCCGACTAAGAAATTTT -3'
(R):5'- TGATCTTGGCATCAATTTTGCT -3'

Sequencing Primer
(F):5'- CCGACTAAGAAATTTTGAAGCGC -3'
(R):5'- ATAAGAACCTTGATTGGGTGCCC -3'
Posted On2020-07-13