Incidental Mutation 'R8162:Olfr487'
ID633574
Institutional Source Beutler Lab
Gene Symbol Olfr487
Ensembl Gene ENSMUSG00000095929
Gene Nameolfactory receptor 487
SynonymsMOR204-31P, MOR204-29P, GA_x6K02T2PBJ9-10541702-10540758, Olfr1538-ps1, MOR204-31P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R8162 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location108208868-108214636 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108211788 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 247 (H247R)
Ref Sequence ENSEMBL: ENSMUSP00000080657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081996]
Predicted Effect probably damaging
Transcript: ENSMUST00000081996
AA Change: H247R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080657
Gene: ENSMUSG00000095929
AA Change: H247R

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 6.1e-50 PFAM
Pfam:7tm_1 44 293 1e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7b T A 15: 77,423,230 Q355L probably benign Het
Asb14 A T 14: 26,911,988 Q383H probably benign Het
Ash1l T G 3: 89,070,246 M2661R probably damaging Het
Cacna1e G T 1: 154,701,567 probably null Het
Ccdc40 G T 11: 119,260,044 probably null Het
Cd27 T A 6: 125,233,225 probably null Het
Ces3b T C 8: 105,090,753 L371S possibly damaging Het
Clec4a2 T A 6: 123,140,752 Y210N probably damaging Het
Cpeb2 A T 5: 43,237,338 H553L Het
Cpne8 T C 15: 90,619,678 I95V probably benign Het
D630039A03Rik T C 4: 57,910,525 T96A probably benign Het
Dand5 C A 8: 84,816,518 G110C probably damaging Het
Erich3 C T 3: 154,764,573 T1554M unknown Het
Evi5l T C 8: 4,191,300 S278P probably damaging Het
Fam208b G T 13: 3,599,691 T36N probably damaging Het
Farp2 C A 1: 93,620,603 H1003Q probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gm13741 A C 2: 87,656,102 M273R possibly damaging Het
Gm28363 T A 1: 117,698,911 D26E unknown Het
Gm8674 A T 13: 49,900,371 D700E noncoding transcript Het
Gm9008 C A 6: 76,496,575 A353S probably benign Het
Gtf3c4 G A 2: 28,834,581 Q380* probably null Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Il1a A T 2: 129,306,557 S78T possibly damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Mcc T C 18: 44,449,441 probably null Het
Met A G 6: 17,547,062 D898G probably damaging Het
Mogs T C 6: 83,115,882 V101A probably damaging Het
Mrgpra4 A T 7: 47,981,473 Y127N probably damaging Het
Ms4a18 A G 19: 11,013,707 S8P probably benign Het
Muc4 A T 16: 32,750,379 T148S unknown Het
Nutm1 G A 2: 112,248,472 L1033F probably benign Het
Ocstamp G T 2: 165,397,867 A133D probably damaging Het
Olfr146 T A 9: 39,018,953 D196V probably benign Het
Olfr374 T G 8: 72,110,409 V281G noncoding transcript Het
Olfr466 G A 13: 65,152,920 R232Q probably damaging Het
Papd4 A G 13: 93,167,924 probably null Het
Phf12 C A 11: 78,024,825 P46Q probably damaging Het
Prf1 A G 10: 61,302,970 T236A probably damaging Het
Ptcd3 A G 6: 71,907,814 V47A probably benign Het
Rapgef1 A T 2: 29,735,999 N1071Y probably damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Tango6 C T 8: 106,683,250 P33L possibly damaging Het
Tbc1d2b C T 9: 90,207,884 R864H probably damaging Het
Trav10n A T 14: 53,122,472 I69L probably benign Het
Tsks A G 7: 44,953,872 Q366R probably damaging Het
Vcan G T 13: 89,704,987 S618* probably null Het
Vwf T A 6: 125,645,836 probably null Het
Zfp827 T A 8: 79,060,577 L124* probably null Het
Other mutations in Olfr487
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Olfr487 APN 7 108211726 missense probably benign 0.06
IGL03133:Olfr487 APN 7 108212387 missense possibly damaging 0.94
IGL03326:Olfr487 APN 7 108211630 missense probably benign 0.03
R0141:Olfr487 UTSW 7 108212003 missense possibly damaging 0.59
R0344:Olfr487 UTSW 7 108211742 nonsense probably null
R0595:Olfr487 UTSW 7 108211661 missense probably damaging 1.00
R1427:Olfr487 UTSW 7 108212094 missense probably benign 0.07
R2023:Olfr487 UTSW 7 108211842 missense probably damaging 1.00
R2065:Olfr487 UTSW 7 108212340 missense probably damaging 0.98
R2068:Olfr487 UTSW 7 108212340 missense probably damaging 0.98
R3410:Olfr487 UTSW 7 108212283 missense possibly damaging 0.95
R4024:Olfr487 UTSW 7 108211742 nonsense probably null
R4619:Olfr487 UTSW 7 108212094 missense possibly damaging 0.78
R4738:Olfr487 UTSW 7 108211994 missense probably damaging 0.99
R5004:Olfr487 UTSW 7 108212116 nonsense probably null
R5684:Olfr487 UTSW 7 108212072 nonsense probably null
R6782:Olfr487 UTSW 7 108212463 missense probably benign 0.03
R6889:Olfr487 UTSW 7 108211918 missense probably benign 0.00
R7010:Olfr487 UTSW 7 108212142 missense probably damaging 0.98
R7076:Olfr487 UTSW 7 108211998 missense probably damaging 1.00
R8190:Olfr487 UTSW 7 108211807 missense possibly damaging 0.80
Z1177:Olfr487 UTSW 7 108211969 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTTTTACCAACAACTGACTGCTC -3'
(R):5'- AACTCTCCTGTTCTGATGTGAG -3'

Sequencing Primer
(F):5'- AAAACTGTCTTTTCAGAGCATCC -3'
(R):5'- CTCCTGTTCTGATGTGAGTATCTCAG -3'
Posted On2020-07-13