Incidental Mutation 'R8162:Evi5l'
ID633575
Institutional Source Beutler Lab
Gene Symbol Evi5l
Ensembl Gene ENSMUSG00000011832
Gene Nameecotropic viral integration site 5 like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R8162 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location4166567-4211257 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4191300 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 278 (S278P)
Ref Sequence ENSEMBL: ENSMUSP00000135159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176072] [ENSMUST00000176149] [ENSMUST00000176764] [ENSMUST00000176825] [ENSMUST00000177053]
Predicted Effect probably damaging
Transcript: ENSMUST00000176072
AA Change: S278P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134867
Gene: ENSMUSG00000011832
AA Change: S278P

DomainStartEndE-ValueType
Blast:TBC 27 100 2e-7 BLAST
low complexity region 101 116 N/A INTRINSIC
TBC 117 328 1.57e-85 SMART
internal_repeat_1 415 451 4.14e-7 PROSPERO
coiled coil region 455 478 N/A INTRINSIC
internal_repeat_1 513 549 4.14e-7 PROSPERO
low complexity region 697 708 N/A INTRINSIC
low complexity region 732 743 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176149
AA Change: S278P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135479
Gene: ENSMUSG00000011832
AA Change: S278P

DomainStartEndE-ValueType
Blast:TBC 27 100 2e-7 BLAST
low complexity region 101 116 N/A INTRINSIC
TBC 117 328 1.57e-85 SMART
internal_repeat_1 463 509 1.56e-7 PROSPERO
coiled coil region 513 536 N/A INTRINSIC
internal_repeat_1 563 607 1.56e-7 PROSPERO
low complexity region 755 766 N/A INTRINSIC
low complexity region 790 801 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176764
AA Change: S278P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134857
Gene: ENSMUSG00000011832
AA Change: S278P

DomainStartEndE-ValueType
Blast:TBC 27 100 4e-8 BLAST
low complexity region 101 116 N/A INTRINSIC
TBC 117 328 1.57e-85 SMART
coiled coil region 363 452 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176825
AA Change: S278P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135700
Gene: ENSMUSG00000011832
AA Change: S278P

DomainStartEndE-ValueType
Blast:TBC 27 100 2e-7 BLAST
low complexity region 101 116 N/A INTRINSIC
TBC 117 328 1.57e-85 SMART
internal_repeat_1 452 498 1.86e-7 PROSPERO
coiled coil region 502 525 N/A INTRINSIC
internal_repeat_1 552 596 1.86e-7 PROSPERO
low complexity region 744 755 N/A INTRINSIC
low complexity region 779 790 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177053
AA Change: S278P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000135159
Gene: ENSMUSG00000011832
AA Change: S278P

DomainStartEndE-ValueType
Blast:TBC 27 100 3e-8 BLAST
low complexity region 101 116 N/A INTRINSIC
TBC 117 328 1.57e-85 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7b T A 15: 77,423,230 Q355L probably benign Het
Asb14 A T 14: 26,911,988 Q383H probably benign Het
Ash1l T G 3: 89,070,246 M2661R probably damaging Het
Cacna1e G T 1: 154,701,567 probably null Het
Ccdc40 G T 11: 119,260,044 probably null Het
Cd27 T A 6: 125,233,225 probably null Het
Ces3b T C 8: 105,090,753 L371S possibly damaging Het
Clec4a2 T A 6: 123,140,752 Y210N probably damaging Het
Cpeb2 A T 5: 43,237,338 H553L Het
Cpne8 T C 15: 90,619,678 I95V probably benign Het
D630039A03Rik T C 4: 57,910,525 T96A probably benign Het
Dand5 C A 8: 84,816,518 G110C probably damaging Het
Erich3 C T 3: 154,764,573 T1554M unknown Het
Fam208b G T 13: 3,599,691 T36N probably damaging Het
Farp2 C A 1: 93,620,603 H1003Q probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gm13741 A C 2: 87,656,102 M273R possibly damaging Het
Gm28363 T A 1: 117,698,911 D26E unknown Het
Gm8674 A T 13: 49,900,371 D700E noncoding transcript Het
Gm9008 C A 6: 76,496,575 A353S probably benign Het
Gtf3c4 G A 2: 28,834,581 Q380* probably null Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Il1a A T 2: 129,306,557 S78T possibly damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Mcc T C 18: 44,449,441 probably null Het
Met A G 6: 17,547,062 D898G probably damaging Het
Mogs T C 6: 83,115,882 V101A probably damaging Het
Mrgpra4 A T 7: 47,981,473 Y127N probably damaging Het
Ms4a18 A G 19: 11,013,707 S8P probably benign Het
Muc4 A T 16: 32,750,379 T148S unknown Het
Nutm1 G A 2: 112,248,472 L1033F probably benign Het
Ocstamp G T 2: 165,397,867 A133D probably damaging Het
Olfr146 T A 9: 39,018,953 D196V probably benign Het
Olfr374 T G 8: 72,110,409 V281G noncoding transcript Het
Olfr466 G A 13: 65,152,920 R232Q probably damaging Het
Olfr487 T C 7: 108,211,788 H247R probably damaging Het
Papd4 A G 13: 93,167,924 probably null Het
Phf12 C A 11: 78,024,825 P46Q probably damaging Het
Prf1 A G 10: 61,302,970 T236A probably damaging Het
Ptcd3 A G 6: 71,907,814 V47A probably benign Het
Rapgef1 A T 2: 29,735,999 N1071Y probably damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Tango6 C T 8: 106,683,250 P33L possibly damaging Het
Tbc1d2b C T 9: 90,207,884 R864H probably damaging Het
Trav10n A T 14: 53,122,472 I69L probably benign Het
Tsks A G 7: 44,953,872 Q366R probably damaging Het
Vcan G T 13: 89,704,987 S618* probably null Het
Vwf T A 6: 125,645,836 probably null Het
Zfp827 T A 8: 79,060,577 L124* probably null Het
Other mutations in Evi5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01812:Evi5l APN 8 4193219 critical splice donor site probably null
IGL02143:Evi5l APN 8 4191293 missense probably damaging 0.99
IGL02322:Evi5l APN 8 4187236 splice site probably benign
IGL02528:Evi5l APN 8 4193172 missense probably benign 0.25
IGL02822:Evi5l APN 8 4187248 missense probably damaging 1.00
R0280:Evi5l UTSW 8 4193133 missense probably damaging 1.00
R1764:Evi5l UTSW 8 4203560 missense probably damaging 0.98
R2032:Evi5l UTSW 8 4210622 missense probably damaging 1.00
R2158:Evi5l UTSW 8 4193195 missense probably damaging 0.99
R2175:Evi5l UTSW 8 4187269 missense probably damaging 1.00
R2357:Evi5l UTSW 8 4193113 splice site probably benign
R3055:Evi5l UTSW 8 4191603 nonsense probably null
R3724:Evi5l UTSW 8 4178080 intron probably benign
R3956:Evi5l UTSW 8 4191358 missense possibly damaging 0.72
R4342:Evi5l UTSW 8 4183492 utr 5 prime probably benign
R4621:Evi5l UTSW 8 4202909 intron probably benign
R4622:Evi5l UTSW 8 4202909 intron probably benign
R4959:Evi5l UTSW 8 4205406 missense probably benign 0.00
R4973:Evi5l UTSW 8 4205406 missense probably benign 0.00
R5052:Evi5l UTSW 8 4206019 intron probably benign
R5097:Evi5l UTSW 8 4193317 missense probably damaging 0.97
R5344:Evi5l UTSW 8 4185990 missense possibly damaging 0.78
R5357:Evi5l UTSW 8 4203623 missense possibly damaging 0.63
R5376:Evi5l UTSW 8 4210770 missense probably damaging 0.99
R5382:Evi5l UTSW 8 4178653 intron probably benign
R5500:Evi5l UTSW 8 4191658 missense probably damaging 0.96
R5554:Evi5l UTSW 8 4206491 splice site probably benign
R5689:Evi5l UTSW 8 4205460 nonsense probably null
R5788:Evi5l UTSW 8 4206800 utr 3 prime probably benign
R6321:Evi5l UTSW 8 4203080 missense probably benign
R6520:Evi5l UTSW 8 4205906 missense possibly damaging 0.76
R6620:Evi5l UTSW 8 4206674 missense possibly damaging 0.84
R6707:Evi5l UTSW 8 4206322 missense probably benign
R7232:Evi5l UTSW 8 4205906 missense possibly damaging 0.71
R7692:Evi5l UTSW 8 4200886 missense probably damaging 1.00
R7985:Evi5l UTSW 8 4203536 missense probably benign 0.27
X0062:Evi5l UTSW 8 4191303 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCCATGGCACTCAAAGTTC -3'
(R):5'- AGTCCCATGAGCTTGCTGTC -3'

Sequencing Primer
(F):5'- TGGCACTCAAAGTTCCAGTATGC -3'
(R):5'- AGGCTCAGACCCTCCTTG -3'
Posted On2020-07-13