Incidental Mutation 'R8162:Olfr374'
ID633576
Institutional Source Beutler Lab
Gene Symbol Olfr374
Ensembl Gene ENSMUSG00000046881
Gene Nameolfactory receptor 374
SynonymsGA_x6K02T2NUPS-241490-242431, MOR130-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R8162 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location72107040-72118200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 72110409 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 281 (V281G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000209675] [ENSMUST00000210435]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000055735
AA Change: V281G
SMART Domains Protein: ENSMUSP00000054673
Gene: ENSMUSG00000046881
AA Change: V281G

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.2e-60 PFAM
Pfam:7TM_GPCR_Srsx 35 224 1.3e-6 PFAM
Pfam:7tm_1 41 290 3e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209675
AA Change: V281G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000210435
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7b T A 15: 77,423,230 Q355L probably benign Het
Asb14 A T 14: 26,911,988 Q383H probably benign Het
Ash1l T G 3: 89,070,246 M2661R probably damaging Het
Cacna1e G T 1: 154,701,567 probably null Het
Ccdc40 G T 11: 119,260,044 probably null Het
Cd27 T A 6: 125,233,225 probably null Het
Ces3b T C 8: 105,090,753 L371S possibly damaging Het
Clec4a2 T A 6: 123,140,752 Y210N probably damaging Het
Cpeb2 A T 5: 43,237,338 H553L Het
Cpne8 T C 15: 90,619,678 I95V probably benign Het
D630039A03Rik T C 4: 57,910,525 T96A probably benign Het
Dand5 C A 8: 84,816,518 G110C probably damaging Het
Erich3 C T 3: 154,764,573 T1554M unknown Het
Evi5l T C 8: 4,191,300 S278P probably damaging Het
Fam208b G T 13: 3,599,691 T36N probably damaging Het
Farp2 C A 1: 93,620,603 H1003Q probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gm13741 A C 2: 87,656,102 M273R possibly damaging Het
Gm28363 T A 1: 117,698,911 D26E unknown Het
Gm8674 A T 13: 49,900,371 D700E noncoding transcript Het
Gm9008 C A 6: 76,496,575 A353S probably benign Het
Gtf3c4 G A 2: 28,834,581 Q380* probably null Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Il1a A T 2: 129,306,557 S78T possibly damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Mcc T C 18: 44,449,441 probably null Het
Met A G 6: 17,547,062 D898G probably damaging Het
Mogs T C 6: 83,115,882 V101A probably damaging Het
Mrgpra4 A T 7: 47,981,473 Y127N probably damaging Het
Ms4a18 A G 19: 11,013,707 S8P probably benign Het
Muc4 A T 16: 32,750,379 T148S unknown Het
Nutm1 G A 2: 112,248,472 L1033F probably benign Het
Ocstamp G T 2: 165,397,867 A133D probably damaging Het
Olfr146 T A 9: 39,018,953 D196V probably benign Het
Olfr466 G A 13: 65,152,920 R232Q probably damaging Het
Olfr487 T C 7: 108,211,788 H247R probably damaging Het
Papd4 A G 13: 93,167,924 probably null Het
Phf12 C A 11: 78,024,825 P46Q probably damaging Het
Prf1 A G 10: 61,302,970 T236A probably damaging Het
Ptcd3 A G 6: 71,907,814 V47A probably benign Het
Rapgef1 A T 2: 29,735,999 N1071Y probably damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Tango6 C T 8: 106,683,250 P33L possibly damaging Het
Tbc1d2b C T 9: 90,207,884 R864H probably damaging Het
Trav10n A T 14: 53,122,472 I69L probably benign Het
Tsks A G 7: 44,953,872 Q366R probably damaging Het
Vcan G T 13: 89,704,987 S618* probably null Het
Vwf T A 6: 125,645,836 probably null Het
Zfp827 T A 8: 79,060,577 L124* probably null Het
Other mutations in Olfr374
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03022:Olfr374 APN 8 72110124 missense probably damaging 0.99
IGL03059:Olfr374 APN 8 72109998 missense probably damaging 1.00
R1662:Olfr374 UTSW 8 72109779 missense probably benign 0.09
R1977:Olfr374 UTSW 8 72109854 missense probably benign 0.41
R3965:Olfr374 UTSW 8 72110264 missense probably damaging 1.00
R4577:Olfr374 UTSW 8 72110323 nonsense probably null
R4702:Olfr374 UTSW 8 72110200 missense probably damaging 1.00
R4703:Olfr374 UTSW 8 72110200 missense probably damaging 1.00
R4705:Olfr374 UTSW 8 72110200 missense probably damaging 1.00
R4909:Olfr374 UTSW 8 72109581 missense probably damaging 1.00
R6542:Olfr374 UTSW 8 72109871 missense probably damaging 0.98
R6867:Olfr374 UTSW 8 72109863 missense possibly damaging 0.90
R7094:Olfr374 UTSW 8 72109503 intron probably benign
R7148:Olfr374 UTSW 8 72110157 missense possibly damaging 0.50
R8224:Olfr374 UTSW 8 72110379 missense noncoding transcript
Predicted Primers PCR Primer
(F):5'- GTATACACTGTGGGCGCATTG -3'
(R):5'- ACTGATGAATTGAAGCCATGTG -3'

Sequencing Primer
(F):5'- CATCTTCACAGCAGTGTTGAGGATC -3'
(R):5'- AAGCCATGTGAATGTCTCCG -3'
Posted On2020-07-13