Incidental Mutation 'R8162:Zfp827'
ID633577
Institutional Source Beutler Lab
Gene Symbol Zfp827
Ensembl Gene ENSMUSG00000071064
Gene Namezinc finger protein 827
Synonyms2810449M09Rik, D630040G17Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.914) question?
Stock #R8162 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location79028437-79193766 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 79060577 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 124 (L124*)
Ref Sequence ENSEMBL: ENSMUSP00000096214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087927] [ENSMUST00000098614] [ENSMUST00000119254]
Predicted Effect probably null
Transcript: ENSMUST00000087927
AA Change: L124*
SMART Domains Protein: ENSMUSP00000085238
Gene: ENSMUSG00000071064
AA Change: L124*

DomainStartEndE-ValueType
low complexity region 102 128 N/A INTRINSIC
low complexity region 226 256 N/A INTRINSIC
low complexity region 271 298 N/A INTRINSIC
low complexity region 306 342 N/A INTRINSIC
low complexity region 343 348 N/A INTRINSIC
ZnF_C2H2 371 393 6.78e-3 SMART
ZnF_C2H2 399 422 5.59e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000098614
AA Change: L124*
SMART Domains Protein: ENSMUSP00000096214
Gene: ENSMUSG00000071064
AA Change: L124*

DomainStartEndE-ValueType
low complexity region 102 128 N/A INTRINSIC
low complexity region 226 256 N/A INTRINSIC
low complexity region 271 298 N/A INTRINSIC
low complexity region 306 342 N/A INTRINSIC
low complexity region 343 348 N/A INTRINSIC
ZnF_C2H2 371 393 6.78e-3 SMART
ZnF_C2H2 399 421 2.99e-4 SMART
ZnF_C2H2 430 452 5.42e-2 SMART
internal_repeat_2 561 585 3.31e-7 PROSPERO
low complexity region 613 627 N/A INTRINSIC
internal_repeat_2 719 743 3.31e-7 PROSPERO
ZnF_C2H2 814 836 2.4e-3 SMART
ZnF_C2H2 842 864 4.72e-2 SMART
ZnF_C2H2 894 916 1.64e-1 SMART
ZnF_C2H2 926 949 7.89e0 SMART
low complexity region 956 974 N/A INTRINSIC
ZnF_C2H2 1016 1038 1.26e-2 SMART
ZnF_C2H2 1044 1066 3.07e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000119254
AA Change: L124*
SMART Domains Protein: ENSMUSP00000113199
Gene: ENSMUSG00000071064
AA Change: L124*

DomainStartEndE-ValueType
low complexity region 102 128 N/A INTRINSIC
low complexity region 226 256 N/A INTRINSIC
low complexity region 271 298 N/A INTRINSIC
low complexity region 306 342 N/A INTRINSIC
low complexity region 343 348 N/A INTRINSIC
ZnF_C2H2 371 393 6.78e-3 SMART
ZnF_C2H2 399 421 2.99e-4 SMART
ZnF_C2H2 430 452 5.42e-2 SMART
internal_repeat_2 561 585 3.25e-7 PROSPERO
low complexity region 613 627 N/A INTRINSIC
internal_repeat_2 719 743 3.25e-7 PROSPERO
ZnF_C2H2 814 836 2.4e-3 SMART
ZnF_C2H2 842 864 4.72e-2 SMART
ZnF_C2H2 894 916 1.64e-1 SMART
ZnF_C2H2 926 949 7.89e0 SMART
low complexity region 956 974 N/A INTRINSIC
ZnF_C2H2 1016 1038 1.26e-2 SMART
ZnF_C2H2 1044 1066 3.07e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7b T A 15: 77,423,230 Q355L probably benign Het
Asb14 A T 14: 26,911,988 Q383H probably benign Het
Ash1l T G 3: 89,070,246 M2661R probably damaging Het
Cacna1e G T 1: 154,701,567 probably null Het
Ccdc40 G T 11: 119,260,044 probably null Het
Cd27 T A 6: 125,233,225 probably null Het
Ces3b T C 8: 105,090,753 L371S possibly damaging Het
Clec4a2 T A 6: 123,140,752 Y210N probably damaging Het
Cpeb2 A T 5: 43,237,338 H553L Het
Cpne8 T C 15: 90,619,678 I95V probably benign Het
D630039A03Rik T C 4: 57,910,525 T96A probably benign Het
Dand5 C A 8: 84,816,518 G110C probably damaging Het
Erich3 C T 3: 154,764,573 T1554M unknown Het
Evi5l T C 8: 4,191,300 S278P probably damaging Het
Fam208b G T 13: 3,599,691 T36N probably damaging Het
Farp2 C A 1: 93,620,603 H1003Q probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gm13741 A C 2: 87,656,102 M273R possibly damaging Het
Gm28363 T A 1: 117,698,911 D26E unknown Het
Gm8674 A T 13: 49,900,371 D700E noncoding transcript Het
Gm9008 C A 6: 76,496,575 A353S probably benign Het
Gtf3c4 G A 2: 28,834,581 Q380* probably null Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Il1a A T 2: 129,306,557 S78T possibly damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Mcc T C 18: 44,449,441 probably null Het
Met A G 6: 17,547,062 D898G probably damaging Het
Mogs T C 6: 83,115,882 V101A probably damaging Het
Mrgpra4 A T 7: 47,981,473 Y127N probably damaging Het
Ms4a18 A G 19: 11,013,707 S8P probably benign Het
Muc4 A T 16: 32,750,379 T148S unknown Het
Nutm1 G A 2: 112,248,472 L1033F probably benign Het
Ocstamp G T 2: 165,397,867 A133D probably damaging Het
Olfr146 T A 9: 39,018,953 D196V probably benign Het
Olfr374 T G 8: 72,110,409 V281G noncoding transcript Het
Olfr466 G A 13: 65,152,920 R232Q probably damaging Het
Olfr487 T C 7: 108,211,788 H247R probably damaging Het
Papd4 A G 13: 93,167,924 probably null Het
Phf12 C A 11: 78,024,825 P46Q probably damaging Het
Prf1 A G 10: 61,302,970 T236A probably damaging Het
Ptcd3 A G 6: 71,907,814 V47A probably benign Het
Rapgef1 A T 2: 29,735,999 N1071Y probably damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Tango6 C T 8: 106,683,250 P33L possibly damaging Het
Tbc1d2b C T 9: 90,207,884 R864H probably damaging Het
Trav10n A T 14: 53,122,472 I69L probably benign Het
Tsks A G 7: 44,953,872 Q366R probably damaging Het
Vcan G T 13: 89,704,987 S618* probably null Het
Vwf T A 6: 125,645,836 probably null Het
Other mutations in Zfp827
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Zfp827 APN 8 79060733 missense possibly damaging 0.82
IGL01545:Zfp827 APN 8 79070434 missense probably damaging 1.00
IGL01552:Zfp827 APN 8 79076191 missense probably damaging 1.00
IGL02261:Zfp827 APN 8 79180079 missense probably damaging 0.97
IGL02451:Zfp827 APN 8 79060972 missense probably damaging 1.00
IGL03130:Zfp827 APN 8 79060957 missense probably damaging 1.00
IGL03411:Zfp827 APN 8 79076487 missense probably damaging 0.99
E0354:Zfp827 UTSW 8 79136577 missense probably damaging 1.00
R0502:Zfp827 UTSW 8 79179077 splice site probably null
R0547:Zfp827 UTSW 8 79060310 missense probably damaging 1.00
R0926:Zfp827 UTSW 8 79118192 missense probably benign 0.00
R0975:Zfp827 UTSW 8 79061185 missense probably benign 0.00
R1305:Zfp827 UTSW 8 79060894 missense possibly damaging 0.95
R1462:Zfp827 UTSW 8 79076479 missense probably benign
R1462:Zfp827 UTSW 8 79076479 missense probably benign
R1638:Zfp827 UTSW 8 79076346 missense possibly damaging 0.94
R1714:Zfp827 UTSW 8 79060573 missense probably damaging 1.00
R2044:Zfp827 UTSW 8 79076236 missense probably benign
R2132:Zfp827 UTSW 8 79185721 missense possibly damaging 0.53
R3844:Zfp827 UTSW 8 79136619 missense probably damaging 0.99
R4329:Zfp827 UTSW 8 79189834 utr 3 prime probably benign
R4629:Zfp827 UTSW 8 79060382 missense probably damaging 0.99
R4873:Zfp827 UTSW 8 79060774 missense probably damaging 1.00
R4875:Zfp827 UTSW 8 79060774 missense probably damaging 1.00
R4936:Zfp827 UTSW 8 79061183 missense probably benign
R4965:Zfp827 UTSW 8 79061281 missense probably benign
R5103:Zfp827 UTSW 8 79070403 missense probably damaging 1.00
R5366:Zfp827 UTSW 8 79185704 missense possibly damaging 0.94
R5794:Zfp827 UTSW 8 79070442 missense probably damaging 1.00
R5825:Zfp827 UTSW 8 79179016 missense probably damaging 1.00
R6118:Zfp827 UTSW 8 79076438 missense possibly damaging 0.75
R6236:Zfp827 UTSW 8 79070476 missense probably damaging 1.00
R6263:Zfp827 UTSW 8 79179073 missense probably damaging 1.00
R6306:Zfp827 UTSW 8 79060695 missense probably damaging 1.00
R6490:Zfp827 UTSW 8 79189977 utr 3 prime probably benign
R6497:Zfp827 UTSW 8 79180128 missense probably damaging 1.00
R7250:Zfp827 UTSW 8 79190092 missense
R7290:Zfp827 UTSW 8 79189813 missense possibly damaging 0.86
R7443:Zfp827 UTSW 8 79190418 missense
R7708:Zfp827 UTSW 8 79175962 missense probably damaging 1.00
R7754:Zfp827 UTSW 8 79190329 missense
R7836:Zfp827 UTSW 8 79186350 missense probably damaging 1.00
R7995:Zfp827 UTSW 8 79118258 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AAGAGAACTATAAGCTGTCCCTGG -3'
(R):5'- AATTGGTCACTCTGGTCCTGC -3'

Sequencing Primer
(F):5'- GACCGGATCCAAGAGCAGTC -3'
(R):5'- GGTCCTGCTTCTCCGCCAG -3'
Posted On2020-07-13