Incidental Mutation 'R8162:Dand5'
ID633578
Institutional Source Beutler Lab
Gene Symbol Dand5
Ensembl Gene ENSMUSG00000053226
Gene NameDAN domain family member 5, BMP antagonist
SynonymsCerl-2, Cerr2, coco, Dte
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.233) question?
Stock #R8162 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location84815405-84822823 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 84816518 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 110 (G110C)
Ref Sequence ENSEMBL: ENSMUSP00000070057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065539]
Predicted Effect probably damaging
Transcript: ENSMUST00000065539
AA Change: G110C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070057
Gene: ENSMUSG00000053226
AA Change: G110C

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 66 77 N/A INTRINSIC
CT 99 185 4.41e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the BMP (bone morphogenic protein) antagonist family. Like BMPs, BMP antagonists contain cystine knots and typically form homo- and heterodimers. The CAN (cerberus and dan) subfamily of BMP antagonists, to which this gene belongs, is characterized by a C-terminal cystine knot with an eight-membered ring. The antagonistic effect of the secreted protein encoded by this gene is likely due to its direct binding to BMP proteins. As an antagonist of BMP, this gene may play a role in regulating organogenesis, body patterning, and tissue differentiation. In mouse, this protein has been shown to bind Nodal and to inhibit the Nodal signaling pathway which patterns left/right body asymmetry. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display partial neonatal lethality with left pulmonary isomerism, abnormal heart looping, atrial and ventricular septal defects and thoracic situs inversus and surviving pups display partial premature death with abdominal organ position abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7b T A 15: 77,423,230 Q355L probably benign Het
Asb14 A T 14: 26,911,988 Q383H probably benign Het
Ash1l T G 3: 89,070,246 M2661R probably damaging Het
Cacna1e G T 1: 154,701,567 probably null Het
Ccdc40 G T 11: 119,260,044 probably null Het
Cd27 T A 6: 125,233,225 probably null Het
Ces3b T C 8: 105,090,753 L371S possibly damaging Het
Clec4a2 T A 6: 123,140,752 Y210N probably damaging Het
Cpeb2 A T 5: 43,237,338 H553L Het
Cpne8 T C 15: 90,619,678 I95V probably benign Het
D630039A03Rik T C 4: 57,910,525 T96A probably benign Het
Erich3 C T 3: 154,764,573 T1554M unknown Het
Evi5l T C 8: 4,191,300 S278P probably damaging Het
Fam208b G T 13: 3,599,691 T36N probably damaging Het
Farp2 C A 1: 93,620,603 H1003Q probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gm13741 A C 2: 87,656,102 M273R possibly damaging Het
Gm28363 T A 1: 117,698,911 D26E unknown Het
Gm8674 A T 13: 49,900,371 D700E noncoding transcript Het
Gm9008 C A 6: 76,496,575 A353S probably benign Het
Gtf3c4 G A 2: 28,834,581 Q380* probably null Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Il1a A T 2: 129,306,557 S78T possibly damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Mcc T C 18: 44,449,441 probably null Het
Met A G 6: 17,547,062 D898G probably damaging Het
Mogs T C 6: 83,115,882 V101A probably damaging Het
Mrgpra4 A T 7: 47,981,473 Y127N probably damaging Het
Ms4a18 A G 19: 11,013,707 S8P probably benign Het
Muc4 A T 16: 32,750,379 T148S unknown Het
Nutm1 G A 2: 112,248,472 L1033F probably benign Het
Ocstamp G T 2: 165,397,867 A133D probably damaging Het
Olfr146 T A 9: 39,018,953 D196V probably benign Het
Olfr374 T G 8: 72,110,409 V281G noncoding transcript Het
Olfr466 G A 13: 65,152,920 R232Q probably damaging Het
Olfr487 T C 7: 108,211,788 H247R probably damaging Het
Papd4 A G 13: 93,167,924 probably null Het
Phf12 C A 11: 78,024,825 P46Q probably damaging Het
Prf1 A G 10: 61,302,970 T236A probably damaging Het
Ptcd3 A G 6: 71,907,814 V47A probably benign Het
Rapgef1 A T 2: 29,735,999 N1071Y probably damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Tango6 C T 8: 106,683,250 P33L possibly damaging Het
Tbc1d2b C T 9: 90,207,884 R864H probably damaging Het
Trav10n A T 14: 53,122,472 I69L probably benign Het
Tsks A G 7: 44,953,872 Q366R probably damaging Het
Vcan G T 13: 89,704,987 S618* probably null Het
Vwf T A 6: 125,645,836 probably null Het
Zfp827 T A 8: 79,060,577 L124* probably null Het
Other mutations in Dand5
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0600:Dand5 UTSW 8 84816292 missense probably damaging 0.98
R4921:Dand5 UTSW 8 84816484 missense probably damaging 1.00
Z1177:Dand5 UTSW 8 84816337 missense probably benign 0.01
Z1177:Dand5 UTSW 8 84816523 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGATGCTCAGCTCACAGC -3'
(R):5'- AGTAAGTTGCTTCGGGCCAC -3'

Sequencing Primer
(F):5'- ACTTCTGGACCAATACCGTGG -3'
(R):5'- TTCGGGCCACACAACTAGGAG -3'
Posted On2020-07-13