Incidental Mutation 'R8162:Tango6'
ID633580
Institutional Source Beutler Lab
Gene Symbol Tango6
Ensembl Gene ENSMUSG00000041949
Gene Nametransport and golgi organization 6
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8162 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location106683068-106851439 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 106683250 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 33 (P33L)
Ref Sequence ENSEMBL: ENSMUSP00000043953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048359] [ENSMUST00000211979]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048359
AA Change: P33L

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043953
Gene: ENSMUSG00000041949
AA Change: P33L

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 20 41 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
low complexity region 246 259 N/A INTRINSIC
low complexity region 334 350 N/A INTRINSIC
low complexity region 472 486 N/A INTRINSIC
Pfam:RTP1_C1 824 935 1.6e-35 PFAM
low complexity region 998 1013 N/A INTRINSIC
Pfam:RTP1_C2 1026 1059 7.5e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211979
AA Change: P33L

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7b T A 15: 77,423,230 Q355L probably benign Het
Asb14 A T 14: 26,911,988 Q383H probably benign Het
Ash1l T G 3: 89,070,246 M2661R probably damaging Het
Cacna1e G T 1: 154,701,567 probably null Het
Ccdc40 G T 11: 119,260,044 probably null Het
Cd27 T A 6: 125,233,225 probably null Het
Ces3b T C 8: 105,090,753 L371S possibly damaging Het
Clec4a2 T A 6: 123,140,752 Y210N probably damaging Het
Cpeb2 A T 5: 43,237,338 H553L Het
Cpne8 T C 15: 90,619,678 I95V probably benign Het
D630039A03Rik T C 4: 57,910,525 T96A probably benign Het
Dand5 C A 8: 84,816,518 G110C probably damaging Het
Erich3 C T 3: 154,764,573 T1554M unknown Het
Evi5l T C 8: 4,191,300 S278P probably damaging Het
Fam208b G T 13: 3,599,691 T36N probably damaging Het
Farp2 C A 1: 93,620,603 H1003Q probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gm13741 A C 2: 87,656,102 M273R possibly damaging Het
Gm28363 T A 1: 117,698,911 D26E unknown Het
Gm8674 A T 13: 49,900,371 D700E noncoding transcript Het
Gm9008 C A 6: 76,496,575 A353S probably benign Het
Gtf3c4 G A 2: 28,834,581 Q380* probably null Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Il1a A T 2: 129,306,557 S78T possibly damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Mcc T C 18: 44,449,441 probably null Het
Met A G 6: 17,547,062 D898G probably damaging Het
Mogs T C 6: 83,115,882 V101A probably damaging Het
Mrgpra4 A T 7: 47,981,473 Y127N probably damaging Het
Ms4a18 A G 19: 11,013,707 S8P probably benign Het
Muc4 A T 16: 32,750,379 T148S unknown Het
Nutm1 G A 2: 112,248,472 L1033F probably benign Het
Ocstamp G T 2: 165,397,867 A133D probably damaging Het
Olfr146 T A 9: 39,018,953 D196V probably benign Het
Olfr374 T G 8: 72,110,409 V281G noncoding transcript Het
Olfr466 G A 13: 65,152,920 R232Q probably damaging Het
Olfr487 T C 7: 108,211,788 H247R probably damaging Het
Papd4 A G 13: 93,167,924 probably null Het
Phf12 C A 11: 78,024,825 P46Q probably damaging Het
Prf1 A G 10: 61,302,970 T236A probably damaging Het
Ptcd3 A G 6: 71,907,814 V47A probably benign Het
Rapgef1 A T 2: 29,735,999 N1071Y probably damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Tbc1d2b C T 9: 90,207,884 R864H probably damaging Het
Trav10n A T 14: 53,122,472 I69L probably benign Het
Tsks A G 7: 44,953,872 Q366R probably damaging Het
Vcan G T 13: 89,704,987 S618* probably null Het
Vwf T A 6: 125,645,836 probably null Het
Zfp827 T A 8: 79,060,577 L124* probably null Het
Other mutations in Tango6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Tango6 APN 8 106742472 critical splice donor site probably null
IGL00925:Tango6 APN 8 106695445 splice site probably benign
IGL00965:Tango6 APN 8 106742010 splice site probably benign
IGL01412:Tango6 APN 8 106818499 missense probably benign 0.02
IGL02888:Tango6 APN 8 106720665 missense probably damaging 1.00
IGL02892:Tango6 APN 8 106742010 splice site probably benign
R0241:Tango6 UTSW 8 106747361 splice site probably benign
R0494:Tango6 UTSW 8 106735682 splice site probably benign
R1127:Tango6 UTSW 8 106688895 missense probably benign 0.00
R1440:Tango6 UTSW 8 106689039 missense probably damaging 1.00
R1547:Tango6 UTSW 8 106781786 missense probably damaging 0.98
R1921:Tango6 UTSW 8 106688794 missense probably benign 0.06
R2255:Tango6 UTSW 8 106689294 critical splice donor site probably null
R2761:Tango6 UTSW 8 106699032 missense possibly damaging 0.93
R4211:Tango6 UTSW 8 106689224 missense probably benign 0.02
R4463:Tango6 UTSW 8 106689074 missense probably benign 0.29
R4696:Tango6 UTSW 8 106700231 missense possibly damaging 0.73
R4867:Tango6 UTSW 8 106818526 missense probably damaging 1.00
R4946:Tango6 UTSW 8 106718090 nonsense probably null
R5459:Tango6 UTSW 8 106850289 missense probably damaging 1.00
R5522:Tango6 UTSW 8 106695598 critical splice donor site probably null
R5795:Tango6 UTSW 8 106718077 missense probably damaging 1.00
R5878:Tango6 UTSW 8 106689168 missense possibly damaging 0.77
R6318:Tango6 UTSW 8 106818497 missense probably benign
R6335:Tango6 UTSW 8 106692676 missense possibly damaging 0.94
R6633:Tango6 UTSW 8 106718005 missense probably benign 0.00
R6664:Tango6 UTSW 8 106742114 missense probably damaging 1.00
R6838:Tango6 UTSW 8 106742074 missense probably benign 0.00
R6866:Tango6 UTSW 8 106742472 critical splice donor site probably null
R7046:Tango6 UTSW 8 106807116 missense possibly damaging 0.86
R7130:Tango6 UTSW 8 106807101 missense probably damaging 1.00
R7199:Tango6 UTSW 8 106689159 missense probably benign 0.01
R7418:Tango6 UTSW 8 106688834 missense probably benign 0.26
R7480:Tango6 UTSW 8 106696727 missense possibly damaging 0.63
R7704:Tango6 UTSW 8 106698989 missense probably benign 0.03
R7809:Tango6 UTSW 8 106689294 critical splice donor site probably null
R7826:Tango6 UTSW 8 106692613 missense probably benign 0.02
R8085:Tango6 UTSW 8 106720734 missense probably benign 0.32
R8098:Tango6 UTSW 8 106742358 missense possibly damaging 0.81
Z1177:Tango6 UTSW 8 106688792 missense probably benign
Z1177:Tango6 UTSW 8 106696616 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATTCAAAATGGCGGCCG -3'
(R):5'- ATTACACCTGTGTGAAGGCGTC -3'

Sequencing Primer
(F):5'- CGCTCCACTCCAATCATG -3'
(R):5'- TGTGAAGGCGTCTCCAGTC -3'
Posted On2020-07-13