Incidental Mutation 'R8162:Tbc1d2b'
ID633582
Institutional Source Beutler Lab
Gene Symbol Tbc1d2b
Ensembl Gene ENSMUSG00000037410
Gene NameTBC1 domain family, member 2B
Synonyms1810061M12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8162 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location90202027-90270804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 90207884 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 864 (R864H)
Ref Sequence ENSEMBL: ENSMUSP00000045413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041767] [ENSMUST00000167122]
Predicted Effect probably damaging
Transcript: ENSMUST00000041767
AA Change: R864H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045413
Gene: ENSMUSG00000037410
AA Change: R864H

DomainStartEndE-ValueType
PH 35 141 2.66e-9 SMART
low complexity region 324 334 N/A INTRINSIC
low complexity region 343 356 N/A INTRINSIC
Blast:TBC 358 601 2e-25 BLAST
TBC 661 881 3.75e-60 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167122
SMART Domains Protein: ENSMUSP00000129292
Gene: ENSMUSG00000032363

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 174 1.4e-28 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 411 7.2e-17 PFAM
Pfam:Reprolysin_4 224 425 3.6e-9 PFAM
Pfam:Reprolysin 226 437 2.9e-30 PFAM
Pfam:Reprolysin_2 244 427 2.2e-12 PFAM
Pfam:Reprolysin_3 248 383 3.7e-13 PFAM
Blast:ACR 442 513 5e-15 BLAST
TSP1 526 578 4.9e-13 SMART
Pfam:ADAM_spacer1 683 794 1.1e-36 PFAM
TSP1 807 863 1.45e-6 SMART
TSP1 866 908 2.41e-1 SMART
TSP1 929 978 1.45e-6 SMART
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1211 1233 N/A INTRINSIC
TSP1 1385 1435 2.4e-2 SMART
TSP1 1436 1493 1.8e-2 SMART
TSP1 1495 1542 4.82e-2 SMART
TSP1 1543 1600 1.39e-3 SMART
Meta Mutation Damage Score 0.9312 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7b T A 15: 77,423,230 Q355L probably benign Het
Asb14 A T 14: 26,911,988 Q383H probably benign Het
Ash1l T G 3: 89,070,246 M2661R probably damaging Het
Cacna1e G T 1: 154,701,567 probably null Het
Ccdc40 G T 11: 119,260,044 probably null Het
Cd27 T A 6: 125,233,225 probably null Het
Ces3b T C 8: 105,090,753 L371S possibly damaging Het
Clec4a2 T A 6: 123,140,752 Y210N probably damaging Het
Cpeb2 A T 5: 43,237,338 H553L Het
Cpne8 T C 15: 90,619,678 I95V probably benign Het
D630039A03Rik T C 4: 57,910,525 T96A probably benign Het
Dand5 C A 8: 84,816,518 G110C probably damaging Het
Erich3 C T 3: 154,764,573 T1554M unknown Het
Evi5l T C 8: 4,191,300 S278P probably damaging Het
Fam208b G T 13: 3,599,691 T36N probably damaging Het
Farp2 C A 1: 93,620,603 H1003Q probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gm13741 A C 2: 87,656,102 M273R possibly damaging Het
Gm28363 T A 1: 117,698,911 D26E unknown Het
Gm8674 A T 13: 49,900,371 D700E noncoding transcript Het
Gm9008 C A 6: 76,496,575 A353S probably benign Het
Gtf3c4 G A 2: 28,834,581 Q380* probably null Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Il1a A T 2: 129,306,557 S78T possibly damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Mcc T C 18: 44,449,441 probably null Het
Met A G 6: 17,547,062 D898G probably damaging Het
Mogs T C 6: 83,115,882 V101A probably damaging Het
Mrgpra4 A T 7: 47,981,473 Y127N probably damaging Het
Ms4a18 A G 19: 11,013,707 S8P probably benign Het
Muc4 A T 16: 32,750,379 T148S unknown Het
Nutm1 G A 2: 112,248,472 L1033F probably benign Het
Ocstamp G T 2: 165,397,867 A133D probably damaging Het
Olfr146 T A 9: 39,018,953 D196V probably benign Het
Olfr374 T G 8: 72,110,409 V281G noncoding transcript Het
Olfr466 G A 13: 65,152,920 R232Q probably damaging Het
Olfr487 T C 7: 108,211,788 H247R probably damaging Het
Papd4 A G 13: 93,167,924 probably null Het
Phf12 C A 11: 78,024,825 P46Q probably damaging Het
Prf1 A G 10: 61,302,970 T236A probably damaging Het
Ptcd3 A G 6: 71,907,814 V47A probably benign Het
Rapgef1 A T 2: 29,735,999 N1071Y probably damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Tango6 C T 8: 106,683,250 P33L possibly damaging Het
Trav10n A T 14: 53,122,472 I69L probably benign Het
Tsks A G 7: 44,953,872 Q366R probably damaging Het
Vcan G T 13: 89,704,987 S618* probably null Het
Vwf T A 6: 125,645,836 probably null Het
Zfp827 T A 8: 79,060,577 L124* probably null Het
Other mutations in Tbc1d2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Tbc1d2b APN 9 90226209 missense probably benign
IGL00791:Tbc1d2b APN 9 90227428 missense probably benign 0.18
IGL01457:Tbc1d2b APN 9 90205091 missense probably damaging 1.00
IGL01535:Tbc1d2b APN 9 90215473 splice site probably benign
IGL02089:Tbc1d2b APN 9 90222359 missense possibly damaging 0.80
IGL02409:Tbc1d2b APN 9 90222352 missense probably benign 0.00
IGL02799:Tbc1d2b APN 9 90223434 splice site probably benign
IGL03198:Tbc1d2b APN 9 90222457 missense probably damaging 1.00
Leone UTSW 9 90207887 missense probably damaging 1.00
ocelot UTSW 9 90207884 missense probably damaging 1.00
panthera UTSW 9 90226248 missense probably benign
pardo UTSW 9 90219144 missense probably benign 0.13
pardus UTSW 9 90219010 nonsense probably null
roar UTSW 9 90218922 nonsense probably null
R0062:Tbc1d2b UTSW 9 90222302 splice site probably benign
R0062:Tbc1d2b UTSW 9 90222302 splice site probably benign
R0671:Tbc1d2b UTSW 9 90222505 splice site probably benign
R0682:Tbc1d2b UTSW 9 90249862 missense probably benign 0.01
R1074:Tbc1d2b UTSW 9 90222340 missense possibly damaging 0.68
R1075:Tbc1d2b UTSW 9 90222340 missense possibly damaging 0.68
R1140:Tbc1d2b UTSW 9 90226376 missense possibly damaging 0.91
R1892:Tbc1d2b UTSW 9 90218943 missense probably damaging 0.98
R4064:Tbc1d2b UTSW 9 90218922 nonsense probably null
R4541:Tbc1d2b UTSW 9 90205169 missense probably damaging 1.00
R4590:Tbc1d2b UTSW 9 90270500 missense possibly damaging 0.81
R4651:Tbc1d2b UTSW 9 90207887 missense probably damaging 1.00
R4652:Tbc1d2b UTSW 9 90207887 missense probably damaging 1.00
R4971:Tbc1d2b UTSW 9 90218870 missense probably benign 0.00
R5086:Tbc1d2b UTSW 9 90227457 missense probably benign
R5131:Tbc1d2b UTSW 9 90209759 missense probably damaging 1.00
R5205:Tbc1d2b UTSW 9 90207810 missense probably damaging 1.00
R5502:Tbc1d2b UTSW 9 90227443 missense probably benign
R5509:Tbc1d2b UTSW 9 90218969 missense probably damaging 1.00
R5534:Tbc1d2b UTSW 9 90227506 missense possibly damaging 0.89
R5729:Tbc1d2b UTSW 9 90207872 missense probably benign 0.22
R5735:Tbc1d2b UTSW 9 90222409 missense possibly damaging 0.71
R5847:Tbc1d2b UTSW 9 90209724 missense probably damaging 1.00
R5928:Tbc1d2b UTSW 9 90219144 missense probably benign 0.13
R6595:Tbc1d2b UTSW 9 90226092 missense probably benign 0.02
R6766:Tbc1d2b UTSW 9 90226209 missense probably benign
R7563:Tbc1d2b UTSW 9 90219010 nonsense probably null
R7563:Tbc1d2b UTSW 9 90226248 missense probably benign
R8126:Tbc1d2b UTSW 9 90222316 missense probably benign 0.00
X0066:Tbc1d2b UTSW 9 90218658 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTCTAGGAAAGAGCACCACG -3'
(R):5'- ACAAGTCAGTCAGTCACCTTAC -3'

Sequencing Primer
(F):5'- GGCACCCTGGACAACCC -3'
(R):5'- TTACCTCCTAGGAACACGGCTG -3'
Posted On2020-07-13