Incidental Mutation 'R8162:Prf1'
ID633583
Institutional Source Beutler Lab
Gene Symbol Prf1
Ensembl Gene ENSMUSG00000037202
Gene Nameperforin 1 (pore forming protein)
SynonymsPfn, Prf-1, perforin, Pfp
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_011073; MGI: 97551

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8162 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location61297833-61304680 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61302970 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 236 (T236A)
Ref Sequence ENSEMBL: ENSMUSP00000041483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035419]
PDB Structure
The X-ray crystal structure of lymphocyte perforin [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000035419
AA Change: T236A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041483
Gene: ENSMUSG00000037202
AA Change: T236A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MACPF 165 368 1.84e-80 SMART
C2 415 516 1.59e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has structural and functional similarities to complement component 9 (C9). Like C9, this protein creates transmembrane tubules and is capable of lysing non-specifically a variety of target cells. This protein is one of the main cytolytic proteins of cytolytic granules, and it is known to be a key effector molecule for T-cell- and natural killer-cell-mediated cytolysis. Defects in this gene cause familial hemophagocytic lymphohistiocytosis type 2 (HPLH2), a rare and lethal autosomal recessive disorder of early childhood. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit increased susceptibility to viral infection and defective cytotoxic T cell cytolysis and NK cell cytolysis. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(7)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7b T A 15: 77,423,230 Q355L probably benign Het
Asb14 A T 14: 26,911,988 Q383H probably benign Het
Ash1l T G 3: 89,070,246 M2661R probably damaging Het
Cacna1e G T 1: 154,701,567 probably null Het
Ccdc40 G T 11: 119,260,044 probably null Het
Cd27 T A 6: 125,233,225 probably null Het
Ces3b T C 8: 105,090,753 L371S possibly damaging Het
Clec4a2 T A 6: 123,140,752 Y210N probably damaging Het
Cpeb2 A T 5: 43,237,338 H553L Het
Cpne8 T C 15: 90,619,678 I95V probably benign Het
D630039A03Rik T C 4: 57,910,525 T96A probably benign Het
Dand5 C A 8: 84,816,518 G110C probably damaging Het
Erich3 C T 3: 154,764,573 T1554M unknown Het
Evi5l T C 8: 4,191,300 S278P probably damaging Het
Fam208b G T 13: 3,599,691 T36N probably damaging Het
Farp2 C A 1: 93,620,603 H1003Q probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gm13741 A C 2: 87,656,102 M273R possibly damaging Het
Gm28363 T A 1: 117,698,911 D26E unknown Het
Gm8674 A T 13: 49,900,371 D700E noncoding transcript Het
Gm9008 C A 6: 76,496,575 A353S probably benign Het
Gtf3c4 G A 2: 28,834,581 Q380* probably null Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Il1a A T 2: 129,306,557 S78T possibly damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Mcc T C 18: 44,449,441 probably null Het
Met A G 6: 17,547,062 D898G probably damaging Het
Mogs T C 6: 83,115,882 V101A probably damaging Het
Mrgpra4 A T 7: 47,981,473 Y127N probably damaging Het
Ms4a18 A G 19: 11,013,707 S8P probably benign Het
Muc4 A T 16: 32,750,379 T148S unknown Het
Nutm1 G A 2: 112,248,472 L1033F probably benign Het
Ocstamp G T 2: 165,397,867 A133D probably damaging Het
Olfr146 T A 9: 39,018,953 D196V probably benign Het
Olfr374 T G 8: 72,110,409 V281G noncoding transcript Het
Olfr466 G A 13: 65,152,920 R232Q probably damaging Het
Olfr487 T C 7: 108,211,788 H247R probably damaging Het
Papd4 A G 13: 93,167,924 probably null Het
Phf12 C A 11: 78,024,825 P46Q probably damaging Het
Ptcd3 A G 6: 71,907,814 V47A probably benign Het
Rapgef1 A T 2: 29,735,999 N1071Y probably damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Tango6 C T 8: 106,683,250 P33L possibly damaging Het
Tbc1d2b C T 9: 90,207,884 R864H probably damaging Het
Trav10n A T 14: 53,122,472 I69L probably benign Het
Tsks A G 7: 44,953,872 Q366R probably damaging Het
Vcan G T 13: 89,704,987 S618* probably null Het
Vwf T A 6: 125,645,836 probably null Het
Zfp827 T A 8: 79,060,577 L124* probably null Het
Other mutations in Prf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02970:Prf1 APN 10 61300178 missense probably benign
prime UTSW 10 61303722 nonsense probably null
PIT4802001:Prf1 UTSW 10 61300193 missense probably benign 0.01
R0526:Prf1 UTSW 10 61300254 missense probably benign 0.01
R0594:Prf1 UTSW 10 61303722 nonsense probably null
R1237:Prf1 UTSW 10 61303649 missense probably benign 0.00
R1508:Prf1 UTSW 10 61303550 missense probably damaging 1.00
R1553:Prf1 UTSW 10 61303169 missense probably damaging 1.00
R1665:Prf1 UTSW 10 61302887 missense probably benign 0.29
R1716:Prf1 UTSW 10 61300452 missense probably benign 0.01
R1817:Prf1 UTSW 10 61302983 missense probably damaging 1.00
R1818:Prf1 UTSW 10 61302983 missense probably damaging 1.00
R2014:Prf1 UTSW 10 61303895 missense probably benign 0.41
R2307:Prf1 UTSW 10 61303163 missense possibly damaging 0.80
R2901:Prf1 UTSW 10 61300319 missense probably damaging 0.96
R2902:Prf1 UTSW 10 61300319 missense probably damaging 0.96
R4724:Prf1 UTSW 10 61303708 missense probably damaging 1.00
R4781:Prf1 UTSW 10 61300424 missense probably damaging 1.00
R5327:Prf1 UTSW 10 61300258 missense probably benign 0.00
R5850:Prf1 UTSW 10 61300193 missense probably benign 0.00
R5999:Prf1 UTSW 10 61303028 missense probably damaging 1.00
R7356:Prf1 UTSW 10 61303280 missense possibly damaging 0.61
R7508:Prf1 UTSW 10 61300155 missense possibly damaging 0.89
R7714:Prf1 UTSW 10 61300155 missense possibly damaging 0.89
R7716:Prf1 UTSW 10 61300155 missense possibly damaging 0.89
Z1177:Prf1 UTSW 10 61303840 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCACAGTTTTCGCCTGGTAC -3'
(R):5'- AGATCATGCGTGGAGTCCAG -3'

Sequencing Primer
(F):5'- GTTTTCGCCTGGTACAAAAACC -3'
(R):5'- AAGTACTTCGACGTGACGCTC -3'
Posted On2020-07-13