Incidental Mutation 'R8162:Fam208b'
ID633585
Institutional Source Beutler Lab
Gene Symbol Fam208b
Ensembl Gene ENSMUSG00000033799
Gene Namefamily with sequence similarity 208, member B
SynonymsBC016423
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R8162 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location3566035-3611108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 3599691 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 36 (T36N)
Ref Sequence ENSEMBL: ENSMUSP00000093774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096069]
Predicted Effect probably damaging
Transcript: ENSMUST00000096069
AA Change: T36N

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000093774
Gene: ENSMUSG00000033799
AA Change: T36N

DomainStartEndE-ValueType
Pfam:DUF3699 91 167 1.4e-24 PFAM
low complexity region 272 282 N/A INTRINSIC
low complexity region 447 459 N/A INTRINSIC
Pfam:DUF3715 533 695 2.3e-25 PFAM
low complexity region 1156 1168 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 2012 2021 N/A INTRINSIC
low complexity region 2250 2263 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7b T A 15: 77,423,230 Q355L probably benign Het
Asb14 A T 14: 26,911,988 Q383H probably benign Het
Ash1l T G 3: 89,070,246 M2661R probably damaging Het
Cacna1e G T 1: 154,701,567 probably null Het
Ccdc40 G T 11: 119,260,044 probably null Het
Cd27 T A 6: 125,233,225 probably null Het
Ces3b T C 8: 105,090,753 L371S possibly damaging Het
Clec4a2 T A 6: 123,140,752 Y210N probably damaging Het
Cpeb2 A T 5: 43,237,338 H553L Het
Cpne8 T C 15: 90,619,678 I95V probably benign Het
D630039A03Rik T C 4: 57,910,525 T96A probably benign Het
Dand5 C A 8: 84,816,518 G110C probably damaging Het
Erich3 C T 3: 154,764,573 T1554M unknown Het
Evi5l T C 8: 4,191,300 S278P probably damaging Het
Farp2 C A 1: 93,620,603 H1003Q probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gm13741 A C 2: 87,656,102 M273R possibly damaging Het
Gm28363 T A 1: 117,698,911 D26E unknown Het
Gm8674 A T 13: 49,900,371 D700E noncoding transcript Het
Gm9008 C A 6: 76,496,575 A353S probably benign Het
Gtf3c4 G A 2: 28,834,581 Q380* probably null Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Il1a A T 2: 129,306,557 S78T possibly damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Mcc T C 18: 44,449,441 probably null Het
Met A G 6: 17,547,062 D898G probably damaging Het
Mogs T C 6: 83,115,882 V101A probably damaging Het
Mrgpra4 A T 7: 47,981,473 Y127N probably damaging Het
Ms4a18 A G 19: 11,013,707 S8P probably benign Het
Muc4 A T 16: 32,750,379 T148S unknown Het
Nutm1 G A 2: 112,248,472 L1033F probably benign Het
Ocstamp G T 2: 165,397,867 A133D probably damaging Het
Olfr146 T A 9: 39,018,953 D196V probably benign Het
Olfr374 T G 8: 72,110,409 V281G noncoding transcript Het
Olfr466 G A 13: 65,152,920 R232Q probably damaging Het
Olfr487 T C 7: 108,211,788 H247R probably damaging Het
Papd4 A G 13: 93,167,924 probably null Het
Phf12 C A 11: 78,024,825 P46Q probably damaging Het
Prf1 A G 10: 61,302,970 T236A probably damaging Het
Ptcd3 A G 6: 71,907,814 V47A probably benign Het
Rapgef1 A T 2: 29,735,999 N1071Y probably damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Tango6 C T 8: 106,683,250 P33L possibly damaging Het
Tbc1d2b C T 9: 90,207,884 R864H probably damaging Het
Trav10n A T 14: 53,122,472 I69L probably benign Het
Tsks A G 7: 44,953,872 Q366R probably damaging Het
Vcan G T 13: 89,704,987 S618* probably null Het
Vwf T A 6: 125,645,836 probably null Het
Zfp827 T A 8: 79,060,577 L124* probably null Het
Other mutations in Fam208b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Fam208b APN 13 3574832 missense probably benign
IGL00670:Fam208b APN 13 3585241 missense probably benign 0.14
IGL00957:Fam208b APN 13 3577101 missense possibly damaging 0.86
IGL01311:Fam208b APN 13 3575885 missense possibly damaging 0.85
IGL01318:Fam208b APN 13 3575067 missense possibly damaging 0.66
IGL01767:Fam208b APN 13 3576633 missense probably benign 0.00
IGL02073:Fam208b APN 13 3574721 missense probably benign 0.01
IGL02152:Fam208b APN 13 3585371 missense probably benign
IGL02431:Fam208b APN 13 3574736 missense possibly damaging 0.85
IGL02478:Fam208b APN 13 3574661 missense probably benign 0.12
IGL02732:Fam208b APN 13 3573626 missense probably benign 0.09
IGL02745:Fam208b APN 13 3585140 missense probably benign 0.23
IGL02800:Fam208b APN 13 3585154 missense probably benign
IGL02989:Fam208b APN 13 3584820 missense probably benign 0.01
IGL03124:Fam208b APN 13 3574704 missense probably benign 0.41
IGL03154:Fam208b APN 13 3575255 missense possibly damaging 0.56
IGL03216:Fam208b APN 13 3574553 missense probably damaging 0.98
BB001:Fam208b UTSW 13 3594331 missense possibly damaging 0.92
BB011:Fam208b UTSW 13 3594331 missense possibly damaging 0.92
H8562:Fam208b UTSW 13 3577000 missense probably damaging 0.98
PIT4585001:Fam208b UTSW 13 3574979 missense possibly damaging 0.55
R0016:Fam208b UTSW 13 3585170 unclassified probably null
R0016:Fam208b UTSW 13 3585170 unclassified probably null
R0157:Fam208b UTSW 13 3575550 missense probably benign 0.06
R0375:Fam208b UTSW 13 3596842 missense possibly damaging 0.85
R0403:Fam208b UTSW 13 3582052 nonsense probably null
R0472:Fam208b UTSW 13 3588364 missense possibly damaging 0.93
R0517:Fam208b UTSW 13 3566964 missense possibly damaging 0.94
R0586:Fam208b UTSW 13 3590321 missense probably damaging 0.99
R0600:Fam208b UTSW 13 3576054 missense probably benign
R0659:Fam208b UTSW 13 3574448 missense probably damaging 0.99
R1257:Fam208b UTSW 13 3575049 missense probably benign 0.25
R1375:Fam208b UTSW 13 3576029 missense probably benign 0.06
R1443:Fam208b UTSW 13 3575543 missense probably benign 0.00
R1497:Fam208b UTSW 13 3570409 missense probably damaging 0.96
R1544:Fam208b UTSW 13 3590413 missense possibly damaging 0.68
R1554:Fam208b UTSW 13 3576374 missense possibly damaging 0.85
R1629:Fam208b UTSW 13 3574121 missense possibly damaging 0.84
R1633:Fam208b UTSW 13 3581771 missense possibly damaging 0.53
R1661:Fam208b UTSW 13 3573860 missense possibly damaging 0.63
R1673:Fam208b UTSW 13 3584498 critical splice donor site probably null
R1675:Fam208b UTSW 13 3569507 missense possibly damaging 0.65
R1781:Fam208b UTSW 13 3584759 missense possibly damaging 0.95
R1792:Fam208b UTSW 13 3590559 missense possibly damaging 0.91
R1826:Fam208b UTSW 13 3581759 missense probably damaging 0.98
R1920:Fam208b UTSW 13 3576612 missense possibly damaging 0.63
R1983:Fam208b UTSW 13 3574853 missense possibly damaging 0.92
R2016:Fam208b UTSW 13 3576770 missense probably benign 0.41
R2017:Fam208b UTSW 13 3576770 missense probably benign 0.41
R2220:Fam208b UTSW 13 3581872 missense probably benign 0.00
R2513:Fam208b UTSW 13 3582150 missense possibly damaging 0.53
R2898:Fam208b UTSW 13 3585122 missense possibly damaging 0.82
R2904:Fam208b UTSW 13 3582185 missense possibly damaging 0.53
R3149:Fam208b UTSW 13 3574359 missense probably damaging 0.98
R3623:Fam208b UTSW 13 3595556 missense probably benign
R3624:Fam208b UTSW 13 3595556 missense probably benign
R3725:Fam208b UTSW 13 3590538 missense probably benign 0.33
R3835:Fam208b UTSW 13 3575292 missense probably benign 0.01
R3890:Fam208b UTSW 13 3596785 missense probably damaging 0.96
R4023:Fam208b UTSW 13 3584554 missense probably damaging 0.99
R4024:Fam208b UTSW 13 3584554 missense probably damaging 0.99
R4025:Fam208b UTSW 13 3584554 missense probably damaging 0.99
R4050:Fam208b UTSW 13 3573507 missense probably benign 0.09
R4308:Fam208b UTSW 13 3569498 missense probably damaging 0.97
R4484:Fam208b UTSW 13 3581831 missense probably benign 0.12
R4674:Fam208b UTSW 13 3573686 missense possibly damaging 0.69
R4718:Fam208b UTSW 13 3574495 missense probably benign 0.00
R4745:Fam208b UTSW 13 3590069 missense probably benign 0.26
R4776:Fam208b UTSW 13 3570391 missense probably damaging 1.00
R4839:Fam208b UTSW 13 3584807 missense probably damaging 0.96
R4855:Fam208b UTSW 13 3566680 splice site probably null
R5049:Fam208b UTSW 13 3574000 missense probably benign 0.00
R5076:Fam208b UTSW 13 3576357 missense probably benign 0.41
R5287:Fam208b UTSW 13 3575744 missense probably benign 0.41
R5298:Fam208b UTSW 13 3595613 splice site probably null
R5379:Fam208b UTSW 13 3588496 missense probably benign 0.41
R5512:Fam208b UTSW 13 3595517 missense probably damaging 0.99
R5624:Fam208b UTSW 13 3584996 missense possibly damaging 0.66
R5750:Fam208b UTSW 13 3573642 nonsense probably null
R6114:Fam208b UTSW 13 3590081 missense probably damaging 1.00
R6118:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6119:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6269:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6270:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6271:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6272:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6525:Fam208b UTSW 13 3576540 nonsense probably null
R6550:Fam208b UTSW 13 3590519 missense possibly damaging 0.85
R6714:Fam208b UTSW 13 3594189 missense probably benign 0.00
R6797:Fam208b UTSW 13 3576769 missense probably benign 0.26
R6967:Fam208b UTSW 13 3574819 missense probably benign 0.22
R7016:Fam208b UTSW 13 3576857 missense possibly damaging 0.92
R7219:Fam208b UTSW 13 3590521 missense probably damaging 0.99
R7454:Fam208b UTSW 13 3585332 missense probably benign 0.21
R7570:Fam208b UTSW 13 3573621 missense probably damaging 0.99
R7571:Fam208b UTSW 13 3575292 missense probably benign 0.01
R7580:Fam208b UTSW 13 3574752 missense probably damaging 0.99
R7587:Fam208b UTSW 13 3568849 missense possibly damaging 0.83
R7657:Fam208b UTSW 13 3573777 missense probably damaging 0.98
R7810:Fam208b UTSW 13 3575714 missense possibly damaging 0.61
R7909:Fam208b UTSW 13 3573765 missense possibly damaging 0.93
R7924:Fam208b UTSW 13 3594331 missense possibly damaging 0.92
R7945:Fam208b UTSW 13 3576085 missense probably benign
R8005:Fam208b UTSW 13 3575681 missense probably benign
R8067:Fam208b UTSW 13 3569602 missense probably benign
R8112:Fam208b UTSW 13 3569516 missense probably damaging 1.00
R8170:Fam208b UTSW 13 3574881 nonsense probably null
R8240:Fam208b UTSW 13 3574388 missense probably benign
R8263:Fam208b UTSW 13 3575286 missense possibly damaging 0.70
R8263:Fam208b UTSW 13 3590016 missense probably benign 0.03
X0024:Fam208b UTSW 13 3599837 missense probably null 0.99
X0025:Fam208b UTSW 13 3576827 missense probably benign 0.15
X0066:Fam208b UTSW 13 3588441 missense probably benign 0.04
Z1176:Fam208b UTSW 13 3576636 missense probably benign 0.01
Z1176:Fam208b UTSW 13 3588429 missense probably damaging 0.98
Z1177:Fam208b UTSW 13 3574234 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGTTTGTGAACTTCATACTCTACAC -3'
(R):5'- GCACCCACTTCTAAAATCATGTG -3'

Sequencing Primer
(F):5'- TCTACACAATCAAAAGCATCCTAGTG -3'
(R):5'- ACTCTTTGTTTCTTTCTAGACTTGAG -3'
Posted On2020-07-13