Incidental Mutation 'R8162:Asb14'
ID633590
Institutional Source Beutler Lab
Gene Symbol Asb14
Ensembl Gene ENSMUSG00000021898
Gene Nameankyrin repeat and SOCS box-containing 14
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R8162 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location26894557-26915258 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 26911988 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 383 (Q383H)
Ref Sequence ENSEMBL: ENSMUSP00000129753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090337] [ENSMUST00000165929]
Predicted Effect probably benign
Transcript: ENSMUST00000090337
AA Change: Q383H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000087810
Gene: ENSMUSG00000021898
AA Change: Q383H

DomainStartEndE-ValueType
ANK 109 138 9.62e2 SMART
ANK 144 173 2.34e-1 SMART
ANK 177 206 1.7e-3 SMART
ANK 210 239 1.7e-3 SMART
ANK 243 272 2.66e-5 SMART
ANK 276 305 4.75e-2 SMART
ANK 309 337 4.31e2 SMART
ANK 341 370 5.24e-4 SMART
ANK 383 412 3.6e-2 SMART
ANK 413 442 5.45e-2 SMART
ANK 450 477 1.9e3 SMART
SOCS_box 559 601 1.8e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165305
SMART Domains Protein: ENSMUSP00000131669
Gene: ENSMUSG00000021898

DomainStartEndE-ValueType
ANK 26 55 1.7e-3 SMART
ANK 59 88 7.71e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165929
AA Change: Q383H

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000129753
Gene: ENSMUSG00000021898
AA Change: Q383H

DomainStartEndE-ValueType
ANK 109 138 9.62e2 SMART
ANK 144 173 2.34e-1 SMART
ANK 177 206 1.7e-3 SMART
ANK 210 239 1.7e-3 SMART
ANK 243 272 2.66e-5 SMART
ANK 276 305 4.75e-2 SMART
ANK 309 337 4.31e2 SMART
ANK 341 370 5.24e-4 SMART
ANK 383 412 3.6e-2 SMART
ANK 413 442 5.45e-2 SMART
ANK 450 477 1.9e3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. They contain ankyrin repeat sequence and a SOCS box domain. The SOCS box serves to couple suppressor of cytokine signalling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7b T A 15: 77,423,230 Q355L probably benign Het
Ash1l T G 3: 89,070,246 M2661R probably damaging Het
Cacna1e G T 1: 154,701,567 probably null Het
Ccdc40 G T 11: 119,260,044 probably null Het
Cd27 T A 6: 125,233,225 probably null Het
Ces3b T C 8: 105,090,753 L371S possibly damaging Het
Clec4a2 T A 6: 123,140,752 Y210N probably damaging Het
Cpeb2 A T 5: 43,237,338 H553L Het
Cpne8 T C 15: 90,619,678 I95V probably benign Het
D630039A03Rik T C 4: 57,910,525 T96A probably benign Het
Dand5 C A 8: 84,816,518 G110C probably damaging Het
Erich3 C T 3: 154,764,573 T1554M unknown Het
Evi5l T C 8: 4,191,300 S278P probably damaging Het
Fam208b G T 13: 3,599,691 T36N probably damaging Het
Farp2 C A 1: 93,620,603 H1003Q probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gm13741 A C 2: 87,656,102 M273R possibly damaging Het
Gm28363 T A 1: 117,698,911 D26E unknown Het
Gm8674 A T 13: 49,900,371 D700E noncoding transcript Het
Gm9008 C A 6: 76,496,575 A353S probably benign Het
Gtf3c4 G A 2: 28,834,581 Q380* probably null Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Il1a A T 2: 129,306,557 S78T possibly damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Mcc T C 18: 44,449,441 probably null Het
Met A G 6: 17,547,062 D898G probably damaging Het
Mogs T C 6: 83,115,882 V101A probably damaging Het
Mrgpra4 A T 7: 47,981,473 Y127N probably damaging Het
Ms4a18 A G 19: 11,013,707 S8P probably benign Het
Muc4 A T 16: 32,750,379 T148S unknown Het
Nutm1 G A 2: 112,248,472 L1033F probably benign Het
Ocstamp G T 2: 165,397,867 A133D probably damaging Het
Olfr146 T A 9: 39,018,953 D196V probably benign Het
Olfr374 T G 8: 72,110,409 V281G noncoding transcript Het
Olfr466 G A 13: 65,152,920 R232Q probably damaging Het
Olfr487 T C 7: 108,211,788 H247R probably damaging Het
Papd4 A G 13: 93,167,924 probably null Het
Phf12 C A 11: 78,024,825 P46Q probably damaging Het
Prf1 A G 10: 61,302,970 T236A probably damaging Het
Ptcd3 A G 6: 71,907,814 V47A probably benign Het
Rapgef1 A T 2: 29,735,999 N1071Y probably damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Tango6 C T 8: 106,683,250 P33L possibly damaging Het
Tbc1d2b C T 9: 90,207,884 R864H probably damaging Het
Trav10n A T 14: 53,122,472 I69L probably benign Het
Tsks A G 7: 44,953,872 Q366R probably damaging Het
Vcan G T 13: 89,704,987 S618* probably null Het
Vwf T A 6: 125,645,836 probably null Het
Zfp827 T A 8: 79,060,577 L124* probably null Het
Other mutations in Asb14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Asb14 APN 14 26912041 missense probably benign 0.01
IGL01412:Asb14 APN 14 26915065 missense probably damaging 1.00
IGL02805:Asb14 APN 14 26901187 missense possibly damaging 0.89
IGL03100:Asb14 APN 14 26903372 missense probably benign 0.03
R1208:Asb14 UTSW 14 26900418 splice site probably benign
R1707:Asb14 UTSW 14 26901122 missense probably benign 0.14
R1828:Asb14 UTSW 14 26911840 missense possibly damaging 0.67
R3056:Asb14 UTSW 14 26914189 missense possibly damaging 0.62
R3926:Asb14 UTSW 14 26897738 missense possibly damaging 0.92
R4991:Asb14 UTSW 14 26915058 missense probably damaging 1.00
R4996:Asb14 UTSW 14 26912116 missense possibly damaging 0.94
R5306:Asb14 UTSW 14 26911909 missense probably damaging 1.00
R5524:Asb14 UTSW 14 26900451 missense possibly damaging 0.94
R7032:Asb14 UTSW 14 26903455 missense probably benign 0.06
R7202:Asb14 UTSW 14 26900437 missense probably benign 0.13
R7259:Asb14 UTSW 14 26903455 missense probably benign 0.06
R7468:Asb14 UTSW 14 26900848 missense probably benign 0.10
R7733:Asb14 UTSW 14 26912352 missense probably benign 0.00
R7765:Asb14 UTSW 14 26897761 missense probably benign 0.03
R8305:Asb14 UTSW 14 26912097 missense probably benign 0.01
Z1088:Asb14 UTSW 14 26903348 missense probably benign 0.02
Z1177:Asb14 UTSW 14 26912299 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTCAGAGCTCTAAAGGTATTGGTCC -3'
(R):5'- GTAGCGCTGATGGGAAATGC -3'

Sequencing Primer
(F):5'- CTAAAGGTATTGGTCCCAGTCACAG -3'
(R):5'- CAGAAGTAGTTGACGTTGGCCC -3'
Posted On2020-07-13