Incidental Mutation 'R8163:Rngtt'
ID633610
Institutional Source Beutler Lab
Gene Symbol Rngtt
Ensembl Gene ENSMUSG00000028274
Gene NameRNA guanylyltransferase and 5'-phosphatase
Synonymsmouse capping enzyme
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.972) question?
Stock #R8163 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location33310311-33502614 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 33325109 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 110 (C110Y)
Ref Sequence ENSEMBL: ENSMUSP00000103788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029942] [ENSMUST00000108153]
PDB Structure
CRYSTAL STRUCTURE OF THE RNA TRIPHOSPHATASE DOMAIN OF MOUSE MRNA CAPPING ENZYME [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE OXIDIZED RNA TRIPHOSPHATASE DOMAIN OF MOUSE MRNA CAPPING ENZYME [X-RAY DIFFRACTION]
Crystal structure of mammalian capping enzyme (Mce1) and Pol II CTD complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000029942
AA Change: C110Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029942
Gene: ENSMUSG00000028274
AA Change: C110Y

DomainStartEndE-ValueType
Pfam:DSPc 46 179 4.7e-12 PFAM
low complexity region 195 205 N/A INTRINSIC
Pfam:mRNA_cap_enzyme 272 460 1.8e-73 PFAM
Pfam:mRNA_cap_C 463 550 3.7e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108153
AA Change: C110Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103788
Gene: ENSMUSG00000028274
AA Change: C110Y

DomainStartEndE-ValueType
Pfam:DSPc 47 179 2.2e-13 PFAM
low complexity region 195 205 N/A INTRINSIC
Pfam:mRNA_cap_enzyme 272 460 2e-80 PFAM
Pfam:mRNA_cap_C 464 559 1.9e-22 PFAM
low complexity region 577 590 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930022D16Rik A G 11: 109,414,057 I11V unknown Het
Ago3 G T 4: 126,368,584 T391K probably benign Het
Asap1 A G 15: 64,092,050 W1100R probably damaging Het
Bbof1 T C 12: 84,426,762 S289P possibly damaging Het
Cd3d T C 9: 44,985,654 F109L probably benign Het
Cebpd A T 16: 15,887,977 E218V probably damaging Het
Cfl1 T C 19: 5,493,500 probably benign Het
Cpa2 A C 6: 30,564,351 I394L probably damaging Het
Ddx50 C A 10: 62,639,899 V348F possibly damaging Het
Dnajc28 G A 16: 91,616,907 R150* probably null Het
Echs1 A G 7: 140,112,444 V130A possibly damaging Het
Eif2s2 A G 2: 154,892,701 S2P probably benign Het
Fastk A G 5: 24,444,275 I38T probably benign Het
Fat3 G A 9: 15,959,759 R3779C probably damaging Het
Fat4 A T 3: 38,979,732 N2511I possibly damaging Het
Fbxw13 G A 9: 109,183,054 T315I probably benign Het
Fzd5 A T 1: 64,735,193 Y470N probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gm884 A T 11: 103,615,862 I1760K unknown Het
Gpr25 T C 1: 136,259,858 D339G probably damaging Het
Igsf9b T A 9: 27,322,611 probably null Het
Il5 T A 11: 53,723,986 M125K possibly damaging Het
Iqub G A 6: 24,449,715 T717I probably benign Het
Katnb1 T C 8: 95,096,386 F403S probably damaging Het
Krt26 T C 11: 99,329,672 I451V probably benign Het
Krt88 T C 15: 101,453,508 L132P probably damaging Het
Kynu G T 2: 43,628,954 G245V probably damaging Het
Lap3 C T 5: 45,512,047 R513* probably null Het
Lin9 C T 1: 180,659,126 R126W probably damaging Het
Lrrtm2 C T 18: 35,213,724 R175H probably damaging Het
N4bp2l2 A G 5: 150,661,309 L60P probably damaging Het
Ncr1 T C 7: 4,340,829 F142S probably damaging Het
Nktr TAGAAG TAG 9: 121,750,863 probably benign Het
Olfr1443 A G 19: 12,680,188 I27V probably benign Het
Parp16 T A 9: 65,229,949 H152Q probably damaging Het
Plaa C G 4: 94,569,403 V777L probably benign Het
Prnp A G 2: 131,936,988 T187A probably benign Het
Pzp T G 6: 128,512,194 I485L probably benign Het
Rc3h1 T A 1: 160,955,059 Y703N probably damaging Het
Rps10 G A 17: 27,634,111 R95C probably benign Het
Scn9a T A 2: 66,484,401 I1658F probably damaging Het
Sec16a A T 2: 26,416,421 W702R Het
Taf6 G T 5: 138,181,976 Q339K possibly damaging Het
Tbcd C T 11: 121,493,885 T315M probably benign Het
Tmem198 C T 1: 75,483,027 P209S possibly damaging Het
Vmn2r78 G A 7: 86,954,452 A613T probably damaging Het
Vps13c G A 9: 67,950,438 E2651K probably benign Het
Wdfy4 C T 14: 33,151,588 V255I Het
Zfhx3 A G 8: 108,949,293 D2325G probably damaging Het
Zfp36l2 T C 17: 84,187,123 N29D possibly damaging Het
Zfp692 T A 11: 58,310,373 probably null Het
Other mutations in Rngtt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01865:Rngtt APN 4 33325157 splice site probably benign
IGL01945:Rngtt APN 4 33339073 missense probably damaging 1.00
IGL02104:Rngtt APN 4 33320517 critical splice acceptor site probably null
IGL02505:Rngtt APN 4 33337936 missense possibly damaging 0.75
IGL02679:Rngtt APN 4 33356098 missense possibly damaging 0.65
IGL03309:Rngtt APN 4 33339091 missense probably damaging 1.00
R0013:Rngtt UTSW 4 33379409 missense probably benign 0.01
R0626:Rngtt UTSW 4 33329598 splice site probably null
R0633:Rngtt UTSW 4 33368690 missense probably damaging 1.00
R1645:Rngtt UTSW 4 33362939 missense probably damaging 1.00
R1670:Rngtt UTSW 4 33368660 missense probably benign
R1700:Rngtt UTSW 4 33330864 missense probably damaging 1.00
R1754:Rngtt UTSW 4 33329634 splice site probably null
R1809:Rngtt UTSW 4 33443614 missense probably benign 0.04
R1929:Rngtt UTSW 4 33500302 nonsense probably null
R2271:Rngtt UTSW 4 33500302 nonsense probably null
R2844:Rngtt UTSW 4 33368678 missense probably benign
R3773:Rngtt UTSW 4 33330889 missense probably damaging 1.00
R4445:Rngtt UTSW 4 33499035 missense probably benign
R4449:Rngtt UTSW 4 33330865 missense probably damaging 1.00
R4510:Rngtt UTSW 4 33339032 missense possibly damaging 0.88
R4511:Rngtt UTSW 4 33339032 missense possibly damaging 0.88
R4578:Rngtt UTSW 4 33339050 missense probably benign 0.30
R4610:Rngtt UTSW 4 33339133 intron probably benign
R4712:Rngtt UTSW 4 33379394 missense probably benign 0.00
R4888:Rngtt UTSW 4 33500335 missense unknown
R4911:Rngtt UTSW 4 33500292 splice site probably null
R5248:Rngtt UTSW 4 33325110 nonsense probably null
R6429:Rngtt UTSW 4 33320606 nonsense probably null
R6571:Rngtt UTSW 4 33379413 missense probably damaging 1.00
R7260:Rngtt UTSW 4 33356176 missense possibly damaging 0.52
R7298:Rngtt UTSW 4 33362927 missense probably damaging 1.00
R7379:Rngtt UTSW 4 33498981 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAAGGTTCTATGACAGAAATGACATAG -3'
(R):5'- GGTCATCCCACACTCTGTCC -3'

Sequencing Primer
(F):5'- GAGAGTGAAAGCTTTCATTGAG -3'
(R):5'- TAGTGAGAGACCTCCTGACTTGAC -3'
Posted On2020-07-13