Incidental Mutation 'R8163:Vmn2r78'
ID 633621
Institutional Source Beutler Lab
Gene Symbol Vmn2r78
Ensembl Gene ENSMUSG00000091962
Gene Name vomeronasal 2, receptor 78
Synonyms
MMRRC Submission 067589-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.071) question?
Stock # R8163 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 86564557-86604385 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 86603660 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 613 (A613T)
Ref Sequence ENSEMBL: ENSMUSP00000126698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170835]
AlphaFold K7N6U5
Predicted Effect probably damaging
Transcript: ENSMUST00000170835
AA Change: A613T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126698
Gene: ENSMUSG00000091962
AA Change: A613T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 75 464 5.9e-31 PFAM
Pfam:NCD3G 507 559 8.1e-21 PFAM
Pfam:7tm_3 592 827 1e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930022D16Rik A G 11: 109,304,883 (GRCm39) I11V unknown Het
Ago3 G T 4: 126,262,377 (GRCm39) T391K probably benign Het
Asap1 A G 15: 63,963,899 (GRCm39) W1100R probably damaging Het
Bbof1 T C 12: 84,473,536 (GRCm39) S289P possibly damaging Het
Cd3d T C 9: 44,896,952 (GRCm39) F109L probably benign Het
Cebpd A T 16: 15,705,841 (GRCm39) E218V probably damaging Het
Cfl1 T C 19: 5,543,528 (GRCm39) probably benign Het
Cpa2 A C 6: 30,564,350 (GRCm39) I394L probably damaging Het
Ddx50 C A 10: 62,475,678 (GRCm39) V348F possibly damaging Het
Dnajc28 G A 16: 91,413,795 (GRCm39) R150* probably null Het
Echs1 A G 7: 139,692,357 (GRCm39) V130A possibly damaging Het
Eif2s2 A G 2: 154,734,621 (GRCm39) S2P probably benign Het
Fastk A G 5: 24,649,273 (GRCm39) I38T probably benign Het
Fat3 G A 9: 15,871,055 (GRCm39) R3779C probably damaging Het
Fat4 A T 3: 39,033,881 (GRCm39) N2511I possibly damaging Het
Fbxw13 G A 9: 109,012,122 (GRCm39) T315I probably benign Het
Fzd5 A T 1: 64,774,352 (GRCm39) Y470N probably damaging Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
Gpr25 T C 1: 136,187,596 (GRCm39) D339G probably damaging Het
Igsf9b T A 9: 27,233,907 (GRCm39) probably null Het
Il5 T A 11: 53,614,813 (GRCm39) M125K possibly damaging Het
Iqub G A 6: 24,449,714 (GRCm39) T717I probably benign Het
Katnb1 T C 8: 95,823,014 (GRCm39) F403S probably damaging Het
Krt26 T C 11: 99,220,498 (GRCm39) I451V probably benign Het
Krt88 T C 15: 101,351,389 (GRCm39) L132P probably damaging Het
Kynu G T 2: 43,518,966 (GRCm39) G245V probably damaging Het
Lap3 C T 5: 45,669,389 (GRCm39) R513* probably null Het
Lin9 C T 1: 180,486,691 (GRCm39) R126W probably damaging Het
Lrrc37 A T 11: 103,506,688 (GRCm39) I1760K unknown Het
Lrrtm2 C T 18: 35,346,777 (GRCm39) R175H probably damaging Het
N4bp2l2 A G 5: 150,584,774 (GRCm39) L60P probably damaging Het
Ncr1 T C 7: 4,343,828 (GRCm39) F142S probably damaging Het
Nktr TAGAAG TAG 9: 121,579,929 (GRCm39) probably benign Het
Or5b95 A G 19: 12,657,552 (GRCm39) I27V probably benign Het
Parp16 T A 9: 65,137,231 (GRCm39) H152Q probably damaging Het
Plaa C G 4: 94,457,640 (GRCm39) V777L probably benign Het
Prnp A G 2: 131,778,908 (GRCm39) T187A probably benign Het
Pzp T G 6: 128,489,157 (GRCm39) I485L probably benign Het
Rc3h1 T A 1: 160,782,629 (GRCm39) Y703N probably damaging Het
Rngtt G A 4: 33,325,109 (GRCm39) C110Y probably damaging Het
Rps10 G A 17: 27,853,085 (GRCm39) R95C probably benign Het
Scn9a T A 2: 66,314,745 (GRCm39) I1658F probably damaging Het
Sec16a A T 2: 26,306,433 (GRCm39) W702R Het
Taf6 G T 5: 138,180,238 (GRCm39) Q339K possibly damaging Het
Tbcd C T 11: 121,384,711 (GRCm39) T315M probably benign Het
Tmem198 C T 1: 75,459,671 (GRCm39) P209S possibly damaging Het
Vps13c G A 9: 67,857,720 (GRCm39) E2651K probably benign Het
Wdfy4 C T 14: 32,873,545 (GRCm39) V255I Het
Zfhx3 A G 8: 109,675,925 (GRCm39) D2325G probably damaging Het
Zfp36l2 T C 17: 84,494,551 (GRCm39) N29D possibly damaging Het
Zfp692 T A 11: 58,201,199 (GRCm39) probably null Het
Other mutations in Vmn2r78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Vmn2r78 APN 7 86,564,569 (GRCm39) missense unknown
IGL01473:Vmn2r78 APN 7 86,569,520 (GRCm39) missense possibly damaging 0.61
IGL01767:Vmn2r78 APN 7 86,603,643 (GRCm39) missense probably benign 0.28
IGL02322:Vmn2r78 APN 7 86,570,687 (GRCm39) missense probably damaging 0.96
IGL02537:Vmn2r78 APN 7 86,603,496 (GRCm39) missense probably damaging 0.99
IGL03297:Vmn2r78 APN 7 86,569,969 (GRCm39) nonsense probably null
ANU74:Vmn2r78 UTSW 7 86,570,273 (GRCm39) missense possibly damaging 0.62
R0035:Vmn2r78 UTSW 7 86,569,413 (GRCm39) missense probably benign 0.22
R0081:Vmn2r78 UTSW 7 86,572,235 (GRCm39) missense probably benign 0.35
R0401:Vmn2r78 UTSW 7 86,570,519 (GRCm39) missense probably benign 0.04
R0751:Vmn2r78 UTSW 7 86,603,588 (GRCm39) missense possibly damaging 0.77
R1341:Vmn2r78 UTSW 7 86,571,477 (GRCm39) missense possibly damaging 0.71
R1386:Vmn2r78 UTSW 7 86,564,615 (GRCm39) missense unknown
R1526:Vmn2r78 UTSW 7 86,571,465 (GRCm39) splice site probably null
R1712:Vmn2r78 UTSW 7 86,604,132 (GRCm39) missense probably damaging 1.00
R1739:Vmn2r78 UTSW 7 86,569,997 (GRCm39) missense probably benign
R1812:Vmn2r78 UTSW 7 86,569,995 (GRCm39) missense probably benign 0.38
R2011:Vmn2r78 UTSW 7 86,604,287 (GRCm39) missense possibly damaging 0.52
R2144:Vmn2r78 UTSW 7 86,603,690 (GRCm39) missense probably damaging 1.00
R2197:Vmn2r78 UTSW 7 86,570,535 (GRCm39) missense probably damaging 0.96
R2291:Vmn2r78 UTSW 7 86,569,362 (GRCm39) missense probably damaging 1.00
R2409:Vmn2r78 UTSW 7 86,569,953 (GRCm39) splice site probably benign
R3023:Vmn2r78 UTSW 7 86,604,174 (GRCm39) missense probably damaging 1.00
R4486:Vmn2r78 UTSW 7 86,569,959 (GRCm39) critical splice acceptor site probably null
R4512:Vmn2r78 UTSW 7 86,569,452 (GRCm39) missense probably benign 0.00
R4515:Vmn2r78 UTSW 7 86,603,466 (GRCm39) missense probably damaging 0.99
R4544:Vmn2r78 UTSW 7 86,570,399 (GRCm39) missense probably benign
R4546:Vmn2r78 UTSW 7 86,603,811 (GRCm39) missense probably damaging 1.00
R4872:Vmn2r78 UTSW 7 86,603,916 (GRCm39) missense possibly damaging 0.87
R4928:Vmn2r78 UTSW 7 86,603,835 (GRCm39) missense probably damaging 1.00
R5101:Vmn2r78 UTSW 7 86,571,563 (GRCm39) missense probably damaging 1.00
R5265:Vmn2r78 UTSW 7 86,569,332 (GRCm39) missense probably damaging 1.00
R5328:Vmn2r78 UTSW 7 86,570,238 (GRCm39) missense probably damaging 0.98
R5442:Vmn2r78 UTSW 7 86,569,330 (GRCm39) missense possibly damaging 0.95
R5567:Vmn2r78 UTSW 7 86,570,737 (GRCm39) missense probably benign 0.17
R5572:Vmn2r78 UTSW 7 86,564,720 (GRCm39) missense probably benign 0.01
R5636:Vmn2r78 UTSW 7 86,603,637 (GRCm39) missense probably damaging 0.99
R5901:Vmn2r78 UTSW 7 86,603,796 (GRCm39) missense probably damaging 1.00
R5977:Vmn2r78 UTSW 7 86,604,115 (GRCm39) missense probably benign 0.00
R5977:Vmn2r78 UTSW 7 86,569,541 (GRCm39) missense possibly damaging 0.74
R6276:Vmn2r78 UTSW 7 86,570,318 (GRCm39) missense probably benign 0.00
R6386:Vmn2r78 UTSW 7 86,571,545 (GRCm39) nonsense probably null
R6724:Vmn2r78 UTSW 7 86,603,466 (GRCm39) missense probably damaging 0.99
R6852:Vmn2r78 UTSW 7 86,603,811 (GRCm39) missense probably damaging 1.00
R6896:Vmn2r78 UTSW 7 86,571,558 (GRCm39) missense probably benign 0.10
R7385:Vmn2r78 UTSW 7 86,571,633 (GRCm39) missense probably benign 0.18
R7578:Vmn2r78 UTSW 7 86,603,552 (GRCm39) nonsense probably null
R7680:Vmn2r78 UTSW 7 86,604,149 (GRCm39) missense probably damaging 1.00
R7748:Vmn2r78 UTSW 7 86,570,343 (GRCm39) missense probably benign 0.00
R7852:Vmn2r78 UTSW 7 86,569,378 (GRCm39) nonsense probably null
R8031:Vmn2r78 UTSW 7 86,604,075 (GRCm39) missense probably damaging 1.00
R8070:Vmn2r78 UTSW 7 86,571,695 (GRCm39) missense probably benign 0.01
R8085:Vmn2r78 UTSW 7 86,603,998 (GRCm39) missense probably benign 0.00
R8501:Vmn2r78 UTSW 7 86,570,094 (GRCm39) missense probably damaging 0.99
R8749:Vmn2r78 UTSW 7 86,603,513 (GRCm39) missense possibly damaging 0.81
R9209:Vmn2r78 UTSW 7 86,569,431 (GRCm39) missense probably benign 0.08
RF018:Vmn2r78 UTSW 7 86,603,639 (GRCm39) nonsense probably null
Z1177:Vmn2r78 UTSW 7 86,603,982 (GRCm39) missense probably benign 0.02
Z1177:Vmn2r78 UTSW 7 86,570,415 (GRCm39) missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- CAGAGGATGAGTATGCCAACACTG -3'
(R):5'- AAGTAGCAGCCACCTCAGTC -3'

Sequencing Primer
(F):5'- GATGAGTATGCCAACACTGATCAAAC -3'
(R):5'- GCTAAGACTACAGTAATTGTCTTGG -3'
Posted On 2020-07-13