Incidental Mutation 'R8163:Vmn2r78'
ID 633621
Institutional Source Beutler Lab
Gene Symbol Vmn2r78
Ensembl Gene ENSMUSG00000091962
Gene Name vomeronasal 2, receptor 78
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock # R8163 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 86915300-86955177 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 86954452 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 613 (A613T)
Ref Sequence ENSEMBL: ENSMUSP00000126698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170835]
AlphaFold K7N6U5
Predicted Effect probably damaging
Transcript: ENSMUST00000170835
AA Change: A613T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126698
Gene: ENSMUSG00000091962
AA Change: A613T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 75 464 5.9e-31 PFAM
Pfam:NCD3G 507 559 8.1e-21 PFAM
Pfam:7tm_3 592 827 1e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930022D16Rik A G 11: 109,414,057 I11V unknown Het
Ago3 G T 4: 126,368,584 T391K probably benign Het
Asap1 A G 15: 64,092,050 W1100R probably damaging Het
Bbof1 T C 12: 84,426,762 S289P possibly damaging Het
Cd3d T C 9: 44,985,654 F109L probably benign Het
Cebpd A T 16: 15,887,977 E218V probably damaging Het
Cfl1 T C 19: 5,493,500 probably benign Het
Cpa2 A C 6: 30,564,351 I394L probably damaging Het
Ddx50 C A 10: 62,639,899 V348F possibly damaging Het
Dnajc28 G A 16: 91,616,907 R150* probably null Het
Echs1 A G 7: 140,112,444 V130A possibly damaging Het
Eif2s2 A G 2: 154,892,701 S2P probably benign Het
Fastk A G 5: 24,444,275 I38T probably benign Het
Fat3 G A 9: 15,959,759 R3779C probably damaging Het
Fat4 A T 3: 38,979,732 N2511I possibly damaging Het
Fbxw13 G A 9: 109,183,054 T315I probably benign Het
Fzd5 A T 1: 64,735,193 Y470N probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gm884 A T 11: 103,615,862 I1760K unknown Het
Gpr25 T C 1: 136,259,858 D339G probably damaging Het
Igsf9b T A 9: 27,322,611 probably null Het
Il5 T A 11: 53,723,986 M125K possibly damaging Het
Iqub G A 6: 24,449,715 T717I probably benign Het
Katnb1 T C 8: 95,096,386 F403S probably damaging Het
Krt26 T C 11: 99,329,672 I451V probably benign Het
Krt88 T C 15: 101,453,508 L132P probably damaging Het
Kynu G T 2: 43,628,954 G245V probably damaging Het
Lap3 C T 5: 45,512,047 R513* probably null Het
Lin9 C T 1: 180,659,126 R126W probably damaging Het
Lrrtm2 C T 18: 35,213,724 R175H probably damaging Het
N4bp2l2 A G 5: 150,661,309 L60P probably damaging Het
Ncr1 T C 7: 4,340,829 F142S probably damaging Het
Nktr TAGAAG TAG 9: 121,750,863 probably benign Het
Olfr1443 A G 19: 12,680,188 I27V probably benign Het
Parp16 T A 9: 65,229,949 H152Q probably damaging Het
Plaa C G 4: 94,569,403 V777L probably benign Het
Prnp A G 2: 131,936,988 T187A probably benign Het
Pzp T G 6: 128,512,194 I485L probably benign Het
Rc3h1 T A 1: 160,955,059 Y703N probably damaging Het
Rngtt G A 4: 33,325,109 C110Y probably damaging Het
Rps10 G A 17: 27,634,111 R95C probably benign Het
Scn9a T A 2: 66,484,401 I1658F probably damaging Het
Sec16a A T 2: 26,416,421 W702R Het
Taf6 G T 5: 138,181,976 Q339K possibly damaging Het
Tbcd C T 11: 121,493,885 T315M probably benign Het
Tmem198 C T 1: 75,483,027 P209S possibly damaging Het
Vps13c G A 9: 67,950,438 E2651K probably benign Het
Wdfy4 C T 14: 33,151,588 V255I Het
Zfhx3 A G 8: 108,949,293 D2325G probably damaging Het
Zfp36l2 T C 17: 84,187,123 N29D possibly damaging Het
Zfp692 T A 11: 58,310,373 probably null Het
Other mutations in Vmn2r78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Vmn2r78 APN 7 86915361 missense unknown
IGL01473:Vmn2r78 APN 7 86920312 missense possibly damaging 0.61
IGL01767:Vmn2r78 APN 7 86954435 missense probably benign 0.28
IGL02322:Vmn2r78 APN 7 86921479 missense probably damaging 0.96
IGL02537:Vmn2r78 APN 7 86954288 missense probably damaging 0.99
IGL03297:Vmn2r78 APN 7 86920761 nonsense probably null
ANU74:Vmn2r78 UTSW 7 86921065 missense possibly damaging 0.62
R0035:Vmn2r78 UTSW 7 86920205 missense probably benign 0.22
R0081:Vmn2r78 UTSW 7 86923027 missense probably benign 0.35
R0401:Vmn2r78 UTSW 7 86921311 missense probably benign 0.04
R0751:Vmn2r78 UTSW 7 86954380 missense possibly damaging 0.77
R1341:Vmn2r78 UTSW 7 86922269 missense possibly damaging 0.71
R1386:Vmn2r78 UTSW 7 86915407 missense unknown
R1526:Vmn2r78 UTSW 7 86922257 splice site probably null
R1712:Vmn2r78 UTSW 7 86954924 missense probably damaging 1.00
R1739:Vmn2r78 UTSW 7 86920789 missense probably benign
R1812:Vmn2r78 UTSW 7 86920787 missense probably benign 0.38
R2011:Vmn2r78 UTSW 7 86955079 missense possibly damaging 0.52
R2144:Vmn2r78 UTSW 7 86954482 missense probably damaging 1.00
R2197:Vmn2r78 UTSW 7 86921327 missense probably damaging 0.96
R2291:Vmn2r78 UTSW 7 86920154 missense probably damaging 1.00
R2409:Vmn2r78 UTSW 7 86920745 splice site probably benign
R3023:Vmn2r78 UTSW 7 86954966 missense probably damaging 1.00
R4486:Vmn2r78 UTSW 7 86920751 critical splice acceptor site probably null
R4512:Vmn2r78 UTSW 7 86920244 missense probably benign 0.00
R4515:Vmn2r78 UTSW 7 86954258 missense probably damaging 0.99
R4544:Vmn2r78 UTSW 7 86921191 missense probably benign
R4546:Vmn2r78 UTSW 7 86954603 missense probably damaging 1.00
R4872:Vmn2r78 UTSW 7 86954708 missense possibly damaging 0.87
R4928:Vmn2r78 UTSW 7 86954627 missense probably damaging 1.00
R5101:Vmn2r78 UTSW 7 86922355 missense probably damaging 1.00
R5265:Vmn2r78 UTSW 7 86920124 missense probably damaging 1.00
R5328:Vmn2r78 UTSW 7 86921030 missense probably damaging 0.98
R5442:Vmn2r78 UTSW 7 86920122 missense possibly damaging 0.95
R5567:Vmn2r78 UTSW 7 86921529 missense probably benign 0.17
R5572:Vmn2r78 UTSW 7 86915512 missense probably benign 0.01
R5636:Vmn2r78 UTSW 7 86954429 missense probably damaging 0.99
R5901:Vmn2r78 UTSW 7 86954588 missense probably damaging 1.00
R5977:Vmn2r78 UTSW 7 86920333 missense possibly damaging 0.74
R5977:Vmn2r78 UTSW 7 86954907 missense probably benign 0.00
R6276:Vmn2r78 UTSW 7 86921110 missense probably benign 0.00
R6386:Vmn2r78 UTSW 7 86922337 nonsense probably null
R6724:Vmn2r78 UTSW 7 86954258 missense probably damaging 0.99
R6852:Vmn2r78 UTSW 7 86954603 missense probably damaging 1.00
R6896:Vmn2r78 UTSW 7 86922350 missense probably benign 0.10
R7385:Vmn2r78 UTSW 7 86922425 missense probably benign 0.18
R7578:Vmn2r78 UTSW 7 86954344 nonsense probably null
R7680:Vmn2r78 UTSW 7 86954941 missense probably damaging 1.00
R7748:Vmn2r78 UTSW 7 86921135 missense probably benign 0.00
R7852:Vmn2r78 UTSW 7 86920170 nonsense probably null
R8031:Vmn2r78 UTSW 7 86954867 missense probably damaging 1.00
R8070:Vmn2r78 UTSW 7 86922487 missense probably benign 0.01
R8085:Vmn2r78 UTSW 7 86954790 missense probably benign 0.00
R8501:Vmn2r78 UTSW 7 86920886 missense probably damaging 0.99
R8749:Vmn2r78 UTSW 7 86954305 missense possibly damaging 0.81
R9209:Vmn2r78 UTSW 7 86920223 missense probably benign 0.08
RF018:Vmn2r78 UTSW 7 86954431 nonsense probably null
Z1177:Vmn2r78 UTSW 7 86921207 missense probably benign 0.44
Z1177:Vmn2r78 UTSW 7 86954774 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAGAGGATGAGTATGCCAACACTG -3'
(R):5'- AAGTAGCAGCCACCTCAGTC -3'

Sequencing Primer
(F):5'- GATGAGTATGCCAACACTGATCAAAC -3'
(R):5'- GCTAAGACTACAGTAATTGTCTTGG -3'
Posted On 2020-07-13