Incidental Mutation 'R8163:Parp16'
ID633627
Institutional Source Beutler Lab
Gene Symbol Parp16
Ensembl Gene ENSMUSG00000032392
Gene Namepoly (ADP-ribose) polymerase family, member 16
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8163 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location65195353-65239224 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65229949 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 152 (H152Q)
Ref Sequence ENSEMBL: ENSMUSP00000070098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069000]
Predicted Effect probably damaging
Transcript: ENSMUST00000069000
AA Change: H152Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070098
Gene: ENSMUSG00000032392
AA Change: H152Q

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
Pfam:PARP 90 273 7.8e-40 PFAM
transmembrane domain 291 313 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930022D16Rik A G 11: 109,414,057 I11V unknown Het
Ago3 G T 4: 126,368,584 T391K probably benign Het
Asap1 A G 15: 64,092,050 W1100R probably damaging Het
Bbof1 T C 12: 84,426,762 S289P possibly damaging Het
Cd3d T C 9: 44,985,654 F109L probably benign Het
Cebpd A T 16: 15,887,977 E218V probably damaging Het
Cfl1 T C 19: 5,493,500 probably benign Het
Cpa2 A C 6: 30,564,351 I394L probably damaging Het
Ddx50 C A 10: 62,639,899 V348F possibly damaging Het
Dnajc28 G A 16: 91,616,907 R150* probably null Het
Echs1 A G 7: 140,112,444 V130A possibly damaging Het
Eif2s2 A G 2: 154,892,701 S2P probably benign Het
Fastk A G 5: 24,444,275 I38T probably benign Het
Fat3 G A 9: 15,959,759 R3779C probably damaging Het
Fat4 A T 3: 38,979,732 N2511I possibly damaging Het
Fbxw13 G A 9: 109,183,054 T315I probably benign Het
Fzd5 A T 1: 64,735,193 Y470N probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gm884 A T 11: 103,615,862 I1760K unknown Het
Gpr25 T C 1: 136,259,858 D339G probably damaging Het
Igsf9b T A 9: 27,322,611 probably null Het
Il5 T A 11: 53,723,986 M125K possibly damaging Het
Iqub G A 6: 24,449,715 T717I probably benign Het
Katnb1 T C 8: 95,096,386 F403S probably damaging Het
Krt26 T C 11: 99,329,672 I451V probably benign Het
Krt88 T C 15: 101,453,508 L132P probably damaging Het
Kynu G T 2: 43,628,954 G245V probably damaging Het
Lap3 C T 5: 45,512,047 R513* probably null Het
Lin9 C T 1: 180,659,126 R126W probably damaging Het
Lrrtm2 C T 18: 35,213,724 R175H probably damaging Het
N4bp2l2 A G 5: 150,661,309 L60P probably damaging Het
Ncr1 T C 7: 4,340,829 F142S probably damaging Het
Nktr TAGAAG TAG 9: 121,750,863 probably benign Het
Olfr1443 A G 19: 12,680,188 I27V probably benign Het
Plaa C G 4: 94,569,403 V777L probably benign Het
Prnp A G 2: 131,936,988 T187A probably benign Het
Pzp T G 6: 128,512,194 I485L probably benign Het
Rc3h1 T A 1: 160,955,059 Y703N probably damaging Het
Rngtt G A 4: 33,325,109 C110Y probably damaging Het
Rps10 G A 17: 27,634,111 R95C probably benign Het
Scn9a T A 2: 66,484,401 I1658F probably damaging Het
Sec16a A T 2: 26,416,421 W702R Het
Taf6 G T 5: 138,181,976 Q339K possibly damaging Het
Tbcd C T 11: 121,493,885 T315M probably benign Het
Tmem198 C T 1: 75,483,027 P209S possibly damaging Het
Vmn2r78 G A 7: 86,954,452 A613T probably damaging Het
Vps13c G A 9: 67,950,438 E2651K probably benign Het
Wdfy4 C T 14: 33,151,588 V255I Het
Zfhx3 A G 8: 108,949,293 D2325G probably damaging Het
Zfp36l2 T C 17: 84,187,123 N29D possibly damaging Het
Zfp692 T A 11: 58,310,373 probably null Het
Other mutations in Parp16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Parp16 APN 9 65229963 missense probably damaging 1.00
IGL02390:Parp16 APN 9 65233769 missense possibly damaging 0.82
IGL02650:Parp16 APN 9 65233816 missense probably damaging 0.99
R1845:Parp16 UTSW 9 65215594 missense possibly damaging 0.65
R2860:Parp16 UTSW 9 65233804 missense probably damaging 1.00
R2861:Parp16 UTSW 9 65233804 missense probably damaging 1.00
R4820:Parp16 UTSW 9 65237893 missense probably damaging 0.96
R7802:Parp16 UTSW 9 65229897 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAGCTGTGACTCTGTTTCCC -3'
(R):5'- CAGTTCTGCAGGTCACTCTG -3'

Sequencing Primer
(F):5'- AGCTGTGACTCTGTTTCCCTTTTATG -3'
(R):5'- TGTGGCCTCAGGAAACCTAC -3'
Posted On2020-07-13