Incidental Mutation 'R8164:Lhx9'
ID 633650
Institutional Source Beutler Lab
Gene Symbol Lhx9
Ensembl Gene ENSMUSG00000019230
Gene Name LIM homeobox protein 9
Synonyms 3110009O07Rik, Lhx9 alpha, LH2B
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.696) question?
Stock # R8164 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 138825186-138848577 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 138832780 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 286 (F286L)
Ref Sequence ENSEMBL: ENSMUSP00000107657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019374] [ENSMUST00000046870] [ENSMUST00000093486] [ENSMUST00000112026] [ENSMUST00000112030] [ENSMUST00000194557]
AlphaFold Q9WUH2
Predicted Effect probably damaging
Transcript: ENSMUST00000019374
AA Change: F286L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019374
Gene: ENSMUSG00000019230
AA Change: F286L

DomainStartEndE-ValueType
LIM 70 123 4.48e-17 SMART
LIM 132 186 8.04e-19 SMART
HOX 267 319 1.89e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000046870
AA Change: F277L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036480
Gene: ENSMUSG00000019230
AA Change: F277L

DomainStartEndE-ValueType
LIM 61 114 4.48e-17 SMART
LIM 123 177 8.04e-19 SMART
HOX 258 320 8.07e-22 SMART
low complexity region 344 368 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093486
AA Change: F277L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091198
Gene: ENSMUSG00000019230
AA Change: F277L

DomainStartEndE-ValueType
LIM 61 114 4.48e-17 SMART
LIM 123 177 8.04e-19 SMART
HOX 258 310 1.89e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112026
AA Change: F286L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107657
Gene: ENSMUSG00000019230
AA Change: F286L

DomainStartEndE-ValueType
LIM 70 123 4.48e-17 SMART
LIM 132 186 8.04e-19 SMART
HOX 267 329 8.07e-22 SMART
low complexity region 353 377 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112030
AA Change: F277L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107661
Gene: ENSMUSG00000019230
AA Change: F277L

DomainStartEndE-ValueType
LIM 61 114 4.48e-17 SMART
LIM 123 177 8.04e-19 SMART
HOX 258 310 1.89e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194557
Meta Mutation Damage Score 0.9295 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the LIM homeobox gene family of developmentally expressed transcription factors. The encoded protein contains a homeodomain and two cysteine-rich zinc-binding LIM domains involved in protein-protein interactions. The protein is highly similar to a mouse protein that causes gonadal agenesis when inactivated, suggesting a role in gonadal development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit failed proliferation of the somatic cells of the genital ridge resulting in lack of discrete gonad formation, infertility in both sexes, and female-like genitalia in genetically male mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik T C 19: 3,717,454 V347A probably benign Het
Abca13 A T 11: 9,615,799 I4808F probably damaging Het
Acaa2 C A 18: 74,795,247 Y182* probably null Het
Ankrd44 A T 1: 54,663,979 N644K probably damaging Het
Aurkaip1 T A 4: 155,832,505 M70K probably damaging Het
Brinp1 A T 4: 68,762,921 Y457* probably null Het
Brox A T 1: 183,280,927 C288S possibly damaging Het
Ccdc57 C T 11: 120,897,962 R353H probably benign Het
Cdhr1 A T 14: 37,079,542 S815T probably damaging Het
Cnih4 A G 1: 181,162,126 I101M probably damaging Het
Ctsj T C 13: 61,002,520 T222A probably benign Het
D930015E06Rik A T 3: 83,926,188 Y789* probably null Het
Dab2 C A 15: 6,430,968 D452E possibly damaging Het
Dnah3 A G 7: 119,967,614 I2463T probably damaging Het
Dync1h1 A G 12: 110,616,360 T326A possibly damaging Het
F10 A G 8: 13,050,781 T232A probably benign Het
Fam129a G A 1: 151,717,588 V675M probably benign Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gcdh A G 8: 84,892,552 S128P probably damaging Het
Gm340 T A 19: 41,585,410 V868D probably damaging Het
Golph3l G A 3: 95,617,206 R256Q probably benign Het
Igkv2-109 A G 6: 68,302,869 T25A probably damaging Het
Lrrtm1 A T 6: 77,244,216 N219Y probably damaging Het
Mei4 A G 9: 81,927,589 K242E probably damaging Het
Morc2b T C 17: 33,138,040 M253V probably damaging Het
Myh14 A G 7: 44,625,033 V1277A probably benign Het
N4bp2 T A 5: 65,809,223 W1335R probably damaging Het
Naip6 T A 13: 100,316,289 H88L probably benign Het
Nlrp1b A T 11: 71,228,417 H17Q possibly damaging Het
Olfr404-ps1 A T 11: 74,239,960 Y132F probably damaging Het
P2ry12 C T 3: 59,217,616 V213I possibly damaging Het
Pcdhb21 C A 18: 37,516,004 P729T probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rnf39 C G 17: 36,943,400 R105G probably damaging Het
Sbk1 G A 7: 126,292,539 V382M possibly damaging Het
Sbno1 T C 5: 124,374,621 T1362A probably benign Het
Slc2a13 A G 15: 91,276,078 Y558H probably damaging Het
Tardbp A T 4: 148,618,603 N301K probably benign Het
Tet2 G T 3: 133,467,134 T1789N possibly damaging Het
Tln2 G A 9: 67,319,420 A1261V probably benign Het
Tmprss11c T A 5: 86,231,853 I399F probably damaging Het
Tnfrsf25 C T 4: 152,117,420 T118I possibly damaging Het
Trpc4 A T 3: 54,315,805 M721L probably benign Het
Vav3 A G 3: 109,341,052 K5R probably benign Het
Wdr24 C A 17: 25,825,949 probably null Het
Zc3hc1 A T 6: 30,390,896 I36K probably damaging Het
Other mutations in Lhx9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Lhx9 APN 1 138828680 missense possibly damaging 0.74
IGL01624:Lhx9 APN 1 138832783 nonsense probably null
IGL02149:Lhx9 APN 1 138831434 missense probably damaging 1.00
IGL02452:Lhx9 APN 1 138841842 missense probably damaging 1.00
IGL02982:Lhx9 APN 1 138838611 missense probably damaging 1.00
R0123:Lhx9 UTSW 1 138838679 missense probably damaging 1.00
R0134:Lhx9 UTSW 1 138838679 missense probably damaging 1.00
R0141:Lhx9 UTSW 1 138840006 missense possibly damaging 0.86
R0225:Lhx9 UTSW 1 138838679 missense probably damaging 1.00
R0281:Lhx9 UTSW 1 138832904 missense probably benign 0.00
R1460:Lhx9 UTSW 1 138838709 splice site probably benign
R1932:Lhx9 UTSW 1 138842009 start gained probably benign
R4738:Lhx9 UTSW 1 138832748 missense probably damaging 1.00
R4792:Lhx9 UTSW 1 138838351 missense possibly damaging 0.87
R4820:Lhx9 UTSW 1 138838367 missense probably benign 0.00
R4877:Lhx9 UTSW 1 138838354 missense probably benign 0.04
R6035:Lhx9 UTSW 1 138838543 missense possibly damaging 0.67
R6035:Lhx9 UTSW 1 138838543 missense possibly damaging 0.67
R6825:Lhx9 UTSW 1 138841806 frame shift probably null
R6852:Lhx9 UTSW 1 138841806 frame shift probably null
R6853:Lhx9 UTSW 1 138841806 frame shift probably null
R7264:Lhx9 UTSW 1 138832751 missense probably damaging 0.98
R8097:Lhx9 UTSW 1 138838351 missense probably damaging 0.97
R8245:Lhx9 UTSW 1 138838441 missense probably benign 0.24
R8278:Lhx9 UTSW 1 138838586 missense probably damaging 0.98
R8951:Lhx9 UTSW 1 138841966 missense probably damaging 1.00
Z1177:Lhx9 UTSW 1 138831498 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTCATGTCCAAGTGATTAGGG -3'
(R):5'- CACTGGGTTGACAGCCTTTTG -3'

Sequencing Primer
(F):5'- TCATGTCCAAGTGATTAGGGAAGAG -3'
(R):5'- CTGCATCCTTTAAGCCAGTGTAGAAG -3'
Posted On 2020-07-13