Incidental Mutation 'R8164:Tmprss11c'
ID633665
Institutional Source Beutler Lab
Gene Symbol Tmprss11c
Ensembl Gene ENSMUSG00000061184
Gene Nametransmembrane protease, serine 11c
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8164 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location86231481-86289308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86231853 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 399 (I399F)
Ref Sequence ENSEMBL: ENSMUSP00000062915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059424] [ENSMUST00000196462]
Predicted Effect probably damaging
Transcript: ENSMUST00000059424
AA Change: I399F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062915
Gene: ENSMUSG00000061184
AA Change: I399F

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
SEA 58 183 5.19e-3 SMART
Tryp_SPc 199 425 8.42e-91 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000196462
AA Change: I386F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142902
Gene: ENSMUSG00000061184
AA Change: I386F

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
SEA 58 176 3.6e-4 SMART
Tryp_SPc 186 412 4.1e-93 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik T C 19: 3,717,454 V347A probably benign Het
Abca13 A T 11: 9,615,799 I4808F probably damaging Het
Acaa2 C A 18: 74,795,247 Y182* probably null Het
Ankrd44 A T 1: 54,663,979 N644K probably damaging Het
Aurkaip1 T A 4: 155,832,505 M70K probably damaging Het
Brinp1 A T 4: 68,762,921 Y457* probably null Het
Brox A T 1: 183,280,927 C288S possibly damaging Het
Ccdc57 C T 11: 120,897,962 R353H probably benign Het
Cdhr1 A T 14: 37,079,542 S815T probably damaging Het
Cnih4 A G 1: 181,162,126 I101M probably damaging Het
Ctsj T C 13: 61,002,520 T222A probably benign Het
D930015E06Rik A T 3: 83,926,188 Y789* probably null Het
Dab2 C A 15: 6,430,968 D452E possibly damaging Het
Dnah3 A G 7: 119,967,614 I2463T probably damaging Het
Dync1h1 A G 12: 110,616,360 T326A possibly damaging Het
F10 A G 8: 13,050,781 T232A probably benign Het
Fam129a G A 1: 151,717,588 V675M probably benign Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gcdh A G 8: 84,892,552 S128P probably damaging Het
Gm340 T A 19: 41,585,410 V868D probably damaging Het
Golph3l G A 3: 95,617,206 R256Q probably benign Het
Igkv2-109 A G 6: 68,302,869 T25A probably damaging Het
Lhx9 A T 1: 138,832,780 F286L probably damaging Het
Lrrtm1 A T 6: 77,244,216 N219Y probably damaging Het
Mei4 A G 9: 81,927,589 K242E probably damaging Het
Morc2b T C 17: 33,138,040 M253V probably damaging Het
Myh14 A G 7: 44,625,033 V1277A probably benign Het
N4bp2 T A 5: 65,809,223 W1335R probably damaging Het
Naip6 T A 13: 100,316,289 H88L probably benign Het
Nlrp1b A T 11: 71,228,417 H17Q possibly damaging Het
Olfr404-ps1 A T 11: 74,239,960 Y132F probably damaging Het
P2ry12 C T 3: 59,217,616 V213I possibly damaging Het
Pcdhb21 C A 18: 37,516,004 P729T probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rnf39 C G 17: 36,943,400 R105G probably damaging Het
Sbk1 G A 7: 126,292,539 V382M possibly damaging Het
Sbno1 T C 5: 124,374,621 T1362A probably benign Het
Slc2a13 A G 15: 91,276,078 Y558H probably damaging Het
Tardbp A T 4: 148,618,603 N301K probably benign Het
Tet2 G T 3: 133,467,134 T1789N possibly damaging Het
Tln2 G A 9: 67,319,420 A1261V probably benign Het
Tnfrsf25 C T 4: 152,117,420 T118I possibly damaging Het
Trpc4 A T 3: 54,315,805 M721L probably benign Het
Vav3 A G 3: 109,341,052 K5R probably benign Het
Wdr24 C A 17: 25,825,949 probably null Het
Zc3hc1 A T 6: 30,390,896 I36K probably damaging Het
Other mutations in Tmprss11c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Tmprss11c APN 5 86239395 missense probably benign 0.00
IGL01357:Tmprss11c APN 5 86231807 missense probably damaging 1.00
IGL01809:Tmprss11c APN 5 86237662 missense possibly damaging 0.89
IGL02972:Tmprss11c APN 5 86237833 missense possibly damaging 0.77
IGL03135:Tmprss11c APN 5 86237650 missense probably damaging 1.00
IGL03255:Tmprss11c APN 5 86271482 missense probably damaging 0.99
IGL03355:Tmprss11c APN 5 86231871 missense probably benign 0.03
R0165:Tmprss11c UTSW 5 86231927 splice site probably benign
R0285:Tmprss11c UTSW 5 86271430 missense probably damaging 1.00
R0480:Tmprss11c UTSW 5 86237609 splice site probably benign
R0639:Tmprss11c UTSW 5 86235469 missense probably damaging 1.00
R1554:Tmprss11c UTSW 5 86289260 start codon destroyed possibly damaging 0.59
R1651:Tmprss11c UTSW 5 86239424 missense probably damaging 1.00
R2234:Tmprss11c UTSW 5 86282086 missense probably benign 0.12
R2235:Tmprss11c UTSW 5 86282086 missense probably benign 0.12
R2698:Tmprss11c UTSW 5 86271463 missense probably damaging 1.00
R4787:Tmprss11c UTSW 5 86256453 missense probably benign 0.00
R4962:Tmprss11c UTSW 5 86237710 missense probably damaging 1.00
R5063:Tmprss11c UTSW 5 86237830 missense probably benign 0.28
R5217:Tmprss11c UTSW 5 86256390 missense probably benign
R5366:Tmprss11c UTSW 5 86282134 missense possibly damaging 0.93
R6343:Tmprss11c UTSW 5 86256345 missense probably damaging 1.00
R6598:Tmprss11c UTSW 5 86289233 missense probably benign 0.01
R6681:Tmprss11c UTSW 5 86289260 start codon destroyed possibly damaging 0.59
R7170:Tmprss11c UTSW 5 86237619 critical splice donor site probably null
R7198:Tmprss11c UTSW 5 86231832 missense probably damaging 1.00
R7258:Tmprss11c UTSW 5 86271413 missense probably damaging 1.00
R7382:Tmprss11c UTSW 5 86231864 missense probably benign 0.19
R7391:Tmprss11c UTSW 5 86237791 missense probably damaging 1.00
R7590:Tmprss11c UTSW 5 86239473 missense probably benign 0.01
R7894:Tmprss11c UTSW 5 86231796 missense probably damaging 1.00
R8311:Tmprss11c UTSW 5 86235553 missense probably damaging 1.00
R8416:Tmprss11c UTSW 5 86239417 missense probably damaging 1.00
R8426:Tmprss11c UTSW 5 86231818 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCACCAAGGTAGCAGAGAG -3'
(R):5'- GGCTAGCATCATTTCAAGTACTG -3'

Sequencing Primer
(F):5'- CTAAGAAAATGTGGTTTTGGGATTAC -3'
(R):5'- ACTGAAATATCCAGTGTTTTGTTTTG -3'
Posted On2020-07-13