Incidental Mutation 'R8164:F10'
ID 633673
Institutional Source Beutler Lab
Gene Symbol F10
Ensembl Gene ENSMUSG00000031444
Gene Name coagulation factor X
Synonyms AI194738, Cf10, fX
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8164 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 13037308-13056676 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 13050781 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 232 (T232A)
Ref Sequence ENSEMBL: ENSMUSP00000033821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033821] [ENSMUST00000063820] [ENSMUST00000123768] [ENSMUST00000128418] [ENSMUST00000152034]
AlphaFold O88947
Predicted Effect probably benign
Transcript: ENSMUST00000033821
AA Change: T232A

PolyPhen 2 Score 0.263 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000033821
Gene: ENSMUSG00000031444
AA Change: T232A

DomainStartEndE-ValueType
low complexity region 19 31 N/A INTRINSIC
GLA 34 97 5.98e-32 SMART
EGF_CA 98 134 4.56e-9 SMART
EGF 140 177 2.66e-1 SMART
low complexity region 201 218 N/A INTRINSIC
Tryp_SPc 243 471 9.03e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063820
AA Change: T220A

PolyPhen 2 Score 0.263 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000068389
Gene: ENSMUSG00000031444
AA Change: T220A

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
GLA 22 85 5.98e-32 SMART
EGF_CA 86 122 4.56e-9 SMART
EGF 128 165 2.66e-1 SMART
low complexity region 189 206 N/A INTRINSIC
Tryp_SPc 231 459 9.03e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123768
SMART Domains Protein: ENSMUSP00000116984
Gene: ENSMUSG00000031444

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
GLA 22 85 5.98e-32 SMART
EGF 89 119 2.25e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000128418
AA Change: T220A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121830
Gene: ENSMUSG00000031444
AA Change: T220A

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
GLA 22 85 5.98e-32 SMART
EGF_CA 86 122 4.56e-9 SMART
EGF 128 165 2.66e-1 SMART
low complexity region 189 206 N/A INTRINSIC
Pfam:Trypsin 232 298 4e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000152034
AA Change: T220A

PolyPhen 2 Score 0.799 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117312
Gene: ENSMUSG00000031444
AA Change: T220A

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
GLA 22 85 5.98e-32 SMART
EGF_CA 86 122 4.56e-9 SMART
EGF 128 165 2.66e-1 SMART
low complexity region 189 206 N/A INTRINSIC
Pfam:Trypsin 232 297 1.1e-15 PFAM
Meta Mutation Damage Score 0.4469 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: This gene encodes factor X, a component of both the intrinsic and extrinsic blood coagulation pathways. The encoded protein is a zymogen that undergoes further processing in a vitamin K-dependent manner to generate mature factor X, a heterodimer comprised of disulfide-linked heavy and light chains. The mature factor X is proteolytically activated either by factor IXa (intrinsic pathway) or factor VIIa (extrinsic pathway) to form factor Xa serine endopeptidase. Activated factor Xa catalyzes the conversion of prothrombin to thrombin. A complete lack of the encoded protein is fatal to mice. A severe deficiency of the encoded protein in mice causes age-dependent iron deposition and cardiac fibrosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Most homozygous mice die from fatal bleeding events at embryonic and neonatal stages, with the remaining homozygous mice dying before weaning stages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik T C 19: 3,717,454 V347A probably benign Het
Abca13 A T 11: 9,615,799 I4808F probably damaging Het
Acaa2 C A 18: 74,795,247 Y182* probably null Het
Ankrd44 A T 1: 54,663,979 N644K probably damaging Het
Aurkaip1 T A 4: 155,832,505 M70K probably damaging Het
Brinp1 A T 4: 68,762,921 Y457* probably null Het
Brox A T 1: 183,280,927 C288S possibly damaging Het
Ccdc57 C T 11: 120,897,962 R353H probably benign Het
Cdhr1 A T 14: 37,079,542 S815T probably damaging Het
Cnih4 A G 1: 181,162,126 I101M probably damaging Het
Ctsj T C 13: 61,002,520 T222A probably benign Het
D930015E06Rik A T 3: 83,926,188 Y789* probably null Het
Dab2 C A 15: 6,430,968 D452E possibly damaging Het
Dnah3 A G 7: 119,967,614 I2463T probably damaging Het
Dync1h1 A G 12: 110,616,360 T326A possibly damaging Het
Fam129a G A 1: 151,717,588 V675M probably benign Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gcdh A G 8: 84,892,552 S128P probably damaging Het
Gm340 T A 19: 41,585,410 V868D probably damaging Het
Golph3l G A 3: 95,617,206 R256Q probably benign Het
Igkv2-109 A G 6: 68,302,869 T25A probably damaging Het
Lhx9 A T 1: 138,832,780 F286L probably damaging Het
Lrrtm1 A T 6: 77,244,216 N219Y probably damaging Het
Mei4 A G 9: 81,927,589 K242E probably damaging Het
Morc2b T C 17: 33,138,040 M253V probably damaging Het
Myh14 A G 7: 44,625,033 V1277A probably benign Het
N4bp2 T A 5: 65,809,223 W1335R probably damaging Het
Naip6 T A 13: 100,316,289 H88L probably benign Het
Nlrp1b A T 11: 71,228,417 H17Q possibly damaging Het
Olfr404-ps1 A T 11: 74,239,960 Y132F probably damaging Het
P2ry12 C T 3: 59,217,616 V213I possibly damaging Het
Pcdhb21 C A 18: 37,516,004 P729T probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rnf39 C G 17: 36,943,400 R105G probably damaging Het
Sbk1 G A 7: 126,292,539 V382M possibly damaging Het
Sbno1 T C 5: 124,374,621 T1362A probably benign Het
Slc2a13 A G 15: 91,276,078 Y558H probably damaging Het
Tardbp A T 4: 148,618,603 N301K probably benign Het
Tet2 G T 3: 133,467,134 T1789N possibly damaging Het
Tln2 G A 9: 67,319,420 A1261V probably benign Het
Tmprss11c T A 5: 86,231,853 I399F probably damaging Het
Tnfrsf25 C T 4: 152,117,420 T118I possibly damaging Het
Trpc4 A T 3: 54,315,805 M721L probably benign Het
Vav3 A G 3: 109,341,052 K5R probably benign Het
Wdr24 C A 17: 25,825,949 probably null Het
Zc3hc1 A T 6: 30,390,896 I36K probably damaging Het
Other mutations in F10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01104:F10 APN 8 13055686 missense probably damaging 1.00
IGL01296:F10 APN 8 13055383 missense possibly damaging 0.49
IGL02010:F10 APN 8 13048292 missense probably damaging 0.97
IGL02707:F10 APN 8 13048252 missense probably damaging 1.00
IGL02716:F10 APN 8 13048177 nonsense probably null
IGL03354:F10 APN 8 13045089 missense probably benign 0.00
ju UTSW 8 13055698 missense probably damaging 1.00
PIT4494001:F10 UTSW 8 13053423 missense probably damaging 1.00
R0243:F10 UTSW 8 13048196 missense probably damaging 1.00
R0321:F10 UTSW 8 13053413 missense possibly damaging 0.95
R0416:F10 UTSW 8 13055448 missense probably damaging 1.00
R0421:F10 UTSW 8 13045097 missense probably benign 0.05
R0545:F10 UTSW 8 13048249 missense probably damaging 1.00
R1630:F10 UTSW 8 13055551 missense probably benign 0.00
R1732:F10 UTSW 8 13050764 missense probably damaging 1.00
R1956:F10 UTSW 8 13055422 missense probably damaging 1.00
R4130:F10 UTSW 8 13055584 missense possibly damaging 0.94
R4700:F10 UTSW 8 13039621 missense possibly damaging 0.93
R4989:F10 UTSW 8 13055698 missense probably damaging 1.00
R5133:F10 UTSW 8 13055698 missense probably damaging 1.00
R5134:F10 UTSW 8 13055698 missense probably damaging 1.00
R6826:F10 UTSW 8 13046165 splice site probably null
R7601:F10 UTSW 8 13050781 missense probably benign 0.26
R8936:F10 UTSW 8 13045086 missense probably damaging 1.00
R9165:F10 UTSW 8 13039564 missense probably benign 0.00
R9260:F10 UTSW 8 13055638 missense probably damaging 1.00
R9294:F10 UTSW 8 13048177 nonsense probably null
X0024:F10 UTSW 8 13055859 missense probably benign
Z1177:F10 UTSW 8 13037845 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAGGCCTCTGTGGTCCTATTC -3'
(R):5'- GGTTATCCCACTGGCCTTTG -3'

Sequencing Primer
(F):5'- AGGCCTCTGTGGTCCTATTCTTTTAG -3'
(R):5'- CCTTTGGTGACCCAGAGAG -3'
Posted On 2020-07-13