Incidental Mutation 'R8164:1810055G02Rik'
ID 633692
Institutional Source Beutler Lab
Gene Symbol 1810055G02Rik
Ensembl Gene ENSMUSG00000035372
Gene Name RIKEN cDNA 1810055G02 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock # R8164 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 3708333-3717881 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 3717454 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 347 (V347A)
Ref Sequence ENSEMBL: ENSMUSP00000047063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039048]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000039048
AA Change: V347A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000047063
Gene: ENSMUSG00000035372
AA Change: V347A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 86 97 N/A INTRINSIC
low complexity region 265 288 N/A INTRINSIC
low complexity region 292 310 N/A INTRINSIC
transmembrane domain 343 365 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,615,799 I4808F probably damaging Het
Acaa2 C A 18: 74,795,247 Y182* probably null Het
Ankrd44 A T 1: 54,663,979 N644K probably damaging Het
Aurkaip1 T A 4: 155,832,505 M70K probably damaging Het
Brinp1 A T 4: 68,762,921 Y457* probably null Het
Brox A T 1: 183,280,927 C288S possibly damaging Het
Ccdc57 C T 11: 120,897,962 R353H probably benign Het
Cdhr1 A T 14: 37,079,542 S815T probably damaging Het
Cnih4 A G 1: 181,162,126 I101M probably damaging Het
Ctsj T C 13: 61,002,520 T222A probably benign Het
D930015E06Rik A T 3: 83,926,188 Y789* probably null Het
Dab2 C A 15: 6,430,968 D452E possibly damaging Het
Dnah3 A G 7: 119,967,614 I2463T probably damaging Het
Dync1h1 A G 12: 110,616,360 T326A possibly damaging Het
F10 A G 8: 13,050,781 T232A probably benign Het
Fam129a G A 1: 151,717,588 V675M probably benign Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gcdh A G 8: 84,892,552 S128P probably damaging Het
Gm340 T A 19: 41,585,410 V868D probably damaging Het
Golph3l G A 3: 95,617,206 R256Q probably benign Het
Igkv2-109 A G 6: 68,302,869 T25A probably damaging Het
Lhx9 A T 1: 138,832,780 F286L probably damaging Het
Lrrtm1 A T 6: 77,244,216 N219Y probably damaging Het
Mei4 A G 9: 81,927,589 K242E probably damaging Het
Morc2b T C 17: 33,138,040 M253V probably damaging Het
Myh14 A G 7: 44,625,033 V1277A probably benign Het
N4bp2 T A 5: 65,809,223 W1335R probably damaging Het
Naip6 T A 13: 100,316,289 H88L probably benign Het
Nlrp1b A T 11: 71,228,417 H17Q possibly damaging Het
Olfr404-ps1 A T 11: 74,239,960 Y132F probably damaging Het
P2ry12 C T 3: 59,217,616 V213I possibly damaging Het
Pcdhb21 C A 18: 37,516,004 P729T probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rnf39 C G 17: 36,943,400 R105G probably damaging Het
Sbk1 G A 7: 126,292,539 V382M possibly damaging Het
Sbno1 T C 5: 124,374,621 T1362A probably benign Het
Slc2a13 A G 15: 91,276,078 Y558H probably damaging Het
Tardbp A T 4: 148,618,603 N301K probably benign Het
Tet2 G T 3: 133,467,134 T1789N possibly damaging Het
Tln2 G A 9: 67,319,420 A1261V probably benign Het
Tmprss11c T A 5: 86,231,853 I399F probably damaging Het
Tnfrsf25 C T 4: 152,117,420 T118I possibly damaging Het
Trpc4 A T 3: 54,315,805 M721L probably benign Het
Vav3 A G 3: 109,341,052 K5R probably benign Het
Wdr24 C A 17: 25,825,949 probably null Het
Zc3hc1 A T 6: 30,390,896 I36K probably damaging Het
Other mutations in 1810055G02Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:1810055G02Rik APN 19 3717040 missense probably benign 0.02
IGL02883:1810055G02Rik APN 19 3716972 missense possibly damaging 0.83
R0909:1810055G02Rik UTSW 19 3715788 missense probably benign 0.00
R1482:1810055G02Rik UTSW 19 3717192 missense probably benign 0.01
R2158:1810055G02Rik UTSW 19 3716608 missense possibly damaging 0.46
R4833:1810055G02Rik UTSW 19 3716872 missense possibly damaging 0.87
R5012:1810055G02Rik UTSW 19 3717217 missense possibly damaging 0.92
R5557:1810055G02Rik UTSW 19 3717501 missense possibly damaging 0.66
R7411:1810055G02Rik UTSW 19 3717241 missense possibly damaging 0.92
R7573:1810055G02Rik UTSW 19 3715728 start codon destroyed probably null 0.04
R8265:1810055G02Rik UTSW 19 3716568 missense probably benign 0.00
R8781:1810055G02Rik UTSW 19 3717538 missense possibly damaging 0.90
R8906:1810055G02Rik UTSW 19 3716686 missense possibly damaging 0.82
R9224:1810055G02Rik UTSW 19 3717100 missense possibly damaging 0.66
X0026:1810055G02Rik UTSW 19 3716826 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCCTGACAACAGAGCAGGTG -3'
(R):5'- AGGATCTGGAAGCACTTAGTTTGG -3'

Sequencing Primer
(F):5'- CAACAGAGCAGGTGGGGAC -3'
(R):5'- CTTAGTTTGGTCTGAGGCAAAACAG -3'
Posted On 2020-07-13