Mutagenetix > Incidental Mutations

Incidental Mutation 'R8164:Gm340'

633693

Institutional Source

Beutler Lab

Gene Symbol

Gm340

Ensembl Gene

ENSMUSG00000090673

Gene Name

predicted gene 340

Synonyms

LOC381224

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R8164 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

41582370-41586536 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 41585410 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 868 (V868D)

Ref Sequence

ENSEMBL: ENSMUSP00000128083 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172371]

Predicted Effect

probably damaging
Transcript: ENSMUST00000172371
AA Change: V868D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128083
Gene: ENSMUSG00000090673
AA Change: V868D

Domain	Start	End	E-Value	Type
low complexity region	10	17	N/A	INTRINSIC
low complexity region	438	450	N/A	INTRINSIC
low complexity region	710	724	N/A	INTRINSIC
low complexity region	768	779	N/A	INTRINSIC
Pfam:DUF4553	787	1241	9.7e-179	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

98% (49/50)

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810055G02Rik	T	C	19: 3,717,454	V347A	probably benign	Het
Abca13	A	T	11: 9,615,799	I4808F	probably damaging	Het
Acaa2	C	A	18: 74,795,247	Y182*	probably null	Het
Ankrd44	A	T	1: 54,663,979	N644K	probably damaging	Het
Aurkaip1	T	A	4: 155,832,505	M70K	probably damaging	Het
Brinp1	A	T	4: 68,762,921	Y457*	probably null	Het
Brox	A	T	1: 183,280,927	C288S	possibly damaging	Het
Ccdc57	C	T	11: 120,897,962	R353H	probably benign	Het
Cdhr1	A	T	14: 37,079,542	S815T	probably damaging	Het
Cnih4	A	G	1: 181,162,126	I101M	probably damaging	Het
Ctsj	T	C	13: 61,002,520	T222A	probably benign	Het
D930015E06Rik	A	T	3: 83,926,188	Y789*	probably null	Het
Dab2	C	A	15: 6,430,968	D452E	possibly damaging	Het
Dnah3	A	G	7: 119,967,614	I2463T	probably damaging	Het
Dync1h1	A	G	12: 110,616,360	T326A	possibly damaging	Het
F10	A	G	8: 13,050,781	T232A	probably benign	Het
Fam129a	G	A	1: 151,717,588	V675M	probably benign	Het
G530012D18Rik	C	G	1: 85,577,214	D113E	unknown	Het
Gcdh	A	G	8: 84,892,552	S128P	probably damaging	Het
Golph3l	G	A	3: 95,617,206	R256Q	probably benign	Het
Igkv2-109	A	G	6: 68,302,869	T25A	probably damaging	Het
Lhx9	A	T	1: 138,832,780	F286L	probably damaging	Het
Lrrtm1	A	T	6: 77,244,216	N219Y	probably damaging	Het
Mei4	A	G	9: 81,927,589	K242E	probably damaging	Het
Morc2b	T	C	17: 33,138,040	M253V	probably damaging	Het
Myh14	A	G	7: 44,625,033	V1277A	probably benign	Het
N4bp2	T	A	5: 65,809,223	W1335R	probably damaging	Het
Naip6	T	A	13: 100,316,289	H88L	probably benign	Het
Nlrp1b	A	T	11: 71,228,417	H17Q	possibly damaging	Het
Olfr404-ps1	A	T	11: 74,239,960	Y132F	probably damaging	Het
P2ry12	C	T	3: 59,217,616	V213I	possibly damaging	Het
Pcdhb21	C	A	18: 37,516,004	P729T	probably benign	Het
Rftn1	G	T	17: 50,047,380	A318D	probably damaging	Het
Rnf39	C	G	17: 36,943,400	R105G	probably damaging	Het
Sbk1	G	A	7: 126,292,539	V382M	possibly damaging	Het
Sbno1	T	C	5: 124,374,621	T1362A	probably benign	Het
Slc2a13	A	G	15: 91,276,078	Y558H	probably damaging	Het
Tardbp	A	T	4: 148,618,603	N301K	probably benign	Het
Tet2	G	T	3: 133,467,134	T1789N	possibly damaging	Het
Tln2	G	A	9: 67,319,420	A1261V	probably benign	Het
Tmprss11c	T	A	5: 86,231,853	I399F	probably damaging	Het
Tnfrsf25	C	T	4: 152,117,420	T118I	possibly damaging	Het
Trpc4	A	T	3: 54,315,805	M721L	probably benign	Het
Vav3	A	G	3: 109,341,052	K5R	probably benign	Het
Wdr24	C	A	17: 25,825,949		probably null	Het
Zc3hc1	A	T	6: 30,390,896	I36K	probably damaging	Het

Other mutations in Gm340

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
BB003:Gm340	UTSW	19	41582569	missense	probably benign
BB013:Gm340	UTSW	19	41582569	missense	probably benign
R0006:Gm340	UTSW	19	41584899	missense	probably benign	0.00
R0686:Gm340	UTSW	19	41582372	missense	possibly damaging	0.73
R1104:Gm340	UTSW	19	41586063	missense	probably damaging	0.99
R1278:Gm340	UTSW	19	41584683	missense	probably benign	0.07
R1606:Gm340	UTSW	19	41585074	missense	probably benign	0.35
R1833:Gm340	UTSW	19	41584948	missense	probably benign	0.00
R1905:Gm340	UTSW	19	41583574	missense	possibly damaging	0.73
R2697:Gm340	UTSW	19	41584027	missense	probably benign	0.43
R2881:Gm340	UTSW	19	41583049	missense	probably damaging	1.00
R4720:Gm340	UTSW	19	41585895	missense	probably benign	0.04
R4864:Gm340	UTSW	19	41585364	missense	probably benign
R4908:Gm340	UTSW	19	41584162	missense	probably benign	0.00
R5193:Gm340	UTSW	19	41582530	missense	probably damaging	1.00
R5215:Gm340	UTSW	19	41585932	missense	probably damaging	1.00
R5276:Gm340	UTSW	19	41585039	missense	probably damaging	0.98
R5319:Gm340	UTSW	19	41586352	missense	probably damaging	0.99
R5321:Gm340	UTSW	19	41585204	missense	probably damaging	1.00
R5432:Gm340	UTSW	19	41584603	missense	probably damaging	1.00
R5605:Gm340	UTSW	19	41582863	missense	probably damaging	1.00
R5941:Gm340	UTSW	19	41586400	missense	probably damaging	1.00
R6020:Gm340	UTSW	19	41583547	missense	possibly damaging	0.88
R6024:Gm340	UTSW	19	41583957	missense	possibly damaging	0.84
R6149:Gm340	UTSW	19	41585202	missense	probably damaging	1.00
R6260:Gm340	UTSW	19	41582370	missense	probably null	0.91
R6260:Gm340	UTSW	19	41582371	missense	possibly damaging	0.73
R6476:Gm340	UTSW	19	41583079	missense	probably benign	0.04
R7051:Gm340	UTSW	19	41585752	missense	probably benign	0.05
R7285:Gm340	UTSW	19	41584315	missense	possibly damaging	0.91
R7372:Gm340	UTSW	19	41585506	missense	probably damaging	1.00
R7762:Gm340	UTSW	19	41583667	missense	probably benign	0.02
R7833:Gm340	UTSW	19	41584585	missense	probably benign	0.02
R7926:Gm340	UTSW	19	41582569	missense	probably benign
R8319:Gm340	UTSW	19	41582904	missense	probably damaging	1.00
R8323:Gm340	UTSW	19	41583597	missense	probably benign	0.01
R8327:Gm340	UTSW	19	41582557	missense	probably damaging	1.00
R8423:Gm340	UTSW	19	41585449	missense	possibly damaging	0.95
X0013:Gm340	UTSW	19	41584532	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCCCAAGTTCATAGGATGGTG -3'
(R):5'- TGCCTGTAGTGAACTAGGGTAC -3'

Sequencing Primer
(F):5'- CTGATCGCCAGCTTCAACG -3'
(R):5'- CCTGTAGTGAACTAGGGTACATGGTG -3'

Posted On

2020-07-13