Incidental Mutation 'R8164:Gm340'
ID633693
Institutional Source Beutler Lab
Gene Symbol Gm340
Ensembl Gene ENSMUSG00000090673
Gene Namepredicted gene 340
SynonymsLOC381224
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R8164 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location41582370-41586536 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41585410 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 868 (V868D)
Ref Sequence ENSEMBL: ENSMUSP00000128083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172371]
Predicted Effect probably damaging
Transcript: ENSMUST00000172371
AA Change: V868D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128083
Gene: ENSMUSG00000090673
AA Change: V868D

DomainStartEndE-ValueType
low complexity region 10 17 N/A INTRINSIC
low complexity region 438 450 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
low complexity region 768 779 N/A INTRINSIC
Pfam:DUF4553 787 1241 9.7e-179 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik T C 19: 3,717,454 V347A probably benign Het
Abca13 A T 11: 9,615,799 I4808F probably damaging Het
Acaa2 C A 18: 74,795,247 Y182* probably null Het
Ankrd44 A T 1: 54,663,979 N644K probably damaging Het
Aurkaip1 T A 4: 155,832,505 M70K probably damaging Het
Brinp1 A T 4: 68,762,921 Y457* probably null Het
Brox A T 1: 183,280,927 C288S possibly damaging Het
Ccdc57 C T 11: 120,897,962 R353H probably benign Het
Cdhr1 A T 14: 37,079,542 S815T probably damaging Het
Cnih4 A G 1: 181,162,126 I101M probably damaging Het
Ctsj T C 13: 61,002,520 T222A probably benign Het
D930015E06Rik A T 3: 83,926,188 Y789* probably null Het
Dab2 C A 15: 6,430,968 D452E possibly damaging Het
Dnah3 A G 7: 119,967,614 I2463T probably damaging Het
Dync1h1 A G 12: 110,616,360 T326A possibly damaging Het
F10 A G 8: 13,050,781 T232A probably benign Het
Fam129a G A 1: 151,717,588 V675M probably benign Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gcdh A G 8: 84,892,552 S128P probably damaging Het
Golph3l G A 3: 95,617,206 R256Q probably benign Het
Igkv2-109 A G 6: 68,302,869 T25A probably damaging Het
Lhx9 A T 1: 138,832,780 F286L probably damaging Het
Lrrtm1 A T 6: 77,244,216 N219Y probably damaging Het
Mei4 A G 9: 81,927,589 K242E probably damaging Het
Morc2b T C 17: 33,138,040 M253V probably damaging Het
Myh14 A G 7: 44,625,033 V1277A probably benign Het
N4bp2 T A 5: 65,809,223 W1335R probably damaging Het
Naip6 T A 13: 100,316,289 H88L probably benign Het
Nlrp1b A T 11: 71,228,417 H17Q possibly damaging Het
Olfr404-ps1 A T 11: 74,239,960 Y132F probably damaging Het
P2ry12 C T 3: 59,217,616 V213I possibly damaging Het
Pcdhb21 C A 18: 37,516,004 P729T probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rnf39 C G 17: 36,943,400 R105G probably damaging Het
Sbk1 G A 7: 126,292,539 V382M possibly damaging Het
Sbno1 T C 5: 124,374,621 T1362A probably benign Het
Slc2a13 A G 15: 91,276,078 Y558H probably damaging Het
Tardbp A T 4: 148,618,603 N301K probably benign Het
Tet2 G T 3: 133,467,134 T1789N possibly damaging Het
Tln2 G A 9: 67,319,420 A1261V probably benign Het
Tmprss11c T A 5: 86,231,853 I399F probably damaging Het
Tnfrsf25 C T 4: 152,117,420 T118I possibly damaging Het
Trpc4 A T 3: 54,315,805 M721L probably benign Het
Vav3 A G 3: 109,341,052 K5R probably benign Het
Wdr24 C A 17: 25,825,949 probably null Het
Zc3hc1 A T 6: 30,390,896 I36K probably damaging Het
Other mutations in Gm340
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB003:Gm340 UTSW 19 41582569 missense probably benign
BB013:Gm340 UTSW 19 41582569 missense probably benign
R0006:Gm340 UTSW 19 41584899 missense probably benign 0.00
R0686:Gm340 UTSW 19 41582372 missense possibly damaging 0.73
R1104:Gm340 UTSW 19 41586063 missense probably damaging 0.99
R1278:Gm340 UTSW 19 41584683 missense probably benign 0.07
R1606:Gm340 UTSW 19 41585074 missense probably benign 0.35
R1833:Gm340 UTSW 19 41584948 missense probably benign 0.00
R1905:Gm340 UTSW 19 41583574 missense possibly damaging 0.73
R2697:Gm340 UTSW 19 41584027 missense probably benign 0.43
R2881:Gm340 UTSW 19 41583049 missense probably damaging 1.00
R4720:Gm340 UTSW 19 41585895 missense probably benign 0.04
R4864:Gm340 UTSW 19 41585364 missense probably benign
R4908:Gm340 UTSW 19 41584162 missense probably benign 0.00
R5193:Gm340 UTSW 19 41582530 missense probably damaging 1.00
R5215:Gm340 UTSW 19 41585932 missense probably damaging 1.00
R5276:Gm340 UTSW 19 41585039 missense probably damaging 0.98
R5319:Gm340 UTSW 19 41586352 missense probably damaging 0.99
R5321:Gm340 UTSW 19 41585204 missense probably damaging 1.00
R5432:Gm340 UTSW 19 41584603 missense probably damaging 1.00
R5605:Gm340 UTSW 19 41582863 missense probably damaging 1.00
R5941:Gm340 UTSW 19 41586400 missense probably damaging 1.00
R6020:Gm340 UTSW 19 41583547 missense possibly damaging 0.88
R6024:Gm340 UTSW 19 41583957 missense possibly damaging 0.84
R6149:Gm340 UTSW 19 41585202 missense probably damaging 1.00
R6260:Gm340 UTSW 19 41582370 missense probably null 0.91
R6260:Gm340 UTSW 19 41582371 missense possibly damaging 0.73
R6476:Gm340 UTSW 19 41583079 missense probably benign 0.04
R7051:Gm340 UTSW 19 41585752 missense probably benign 0.05
R7285:Gm340 UTSW 19 41584315 missense possibly damaging 0.91
R7372:Gm340 UTSW 19 41585506 missense probably damaging 1.00
R7762:Gm340 UTSW 19 41583667 missense probably benign 0.02
R7833:Gm340 UTSW 19 41584585 missense probably benign 0.02
R7926:Gm340 UTSW 19 41582569 missense probably benign
R8319:Gm340 UTSW 19 41582904 missense probably damaging 1.00
R8323:Gm340 UTSW 19 41583597 missense probably benign 0.01
R8327:Gm340 UTSW 19 41582557 missense probably damaging 1.00
R8423:Gm340 UTSW 19 41585449 missense possibly damaging 0.95
X0013:Gm340 UTSW 19 41584532 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCCAAGTTCATAGGATGGTG -3'
(R):5'- TGCCTGTAGTGAACTAGGGTAC -3'

Sequencing Primer
(F):5'- CTGATCGCCAGCTTCAACG -3'
(R):5'- CCTGTAGTGAACTAGGGTACATGGTG -3'
Posted On2020-07-13