Mutagenetix > Incidental Mutation

Incidental Mutation 'R8165:Aox2'

633694

Institutional Source

Beutler Lab

Gene Symbol

Aox2

Ensembl Gene

ENSMUSG00000079554

Gene Name

aldehyde oxidase 2

Synonyms

Aox3l1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R8165 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

58278326-58380259 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 58308929 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 602 (H602L)

Ref Sequence

ENSEMBL: ENSMUSP00000110006 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114366]

AlphaFold

Q5SGK3

Predicted Effect

probably benign
Transcript: ENSMUST00000114366
AA Change: H602L

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000110006
Gene: ENSMUSG00000079554
AA Change: H602L

Domain	Start	End	E-Value	Type
Pfam:Fer2	13	83	3.4e-9	PFAM
Pfam:Fer2_2	92	166	4.2e-30	PFAM
Pfam:FAD_binding_5	241	421	5.1e-46	PFAM
CO_deh_flav_C	428	532	1.4e-23	SMART
Ald_Xan_dh_C	604	707	4.64e-47	SMART
Pfam:Ald_Xan_dh_C2	717	1251	1.3e-178	PFAM
low complexity region	1257	1271	N/A	INTRINSIC
low complexity region	1285	1303	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (65/65)

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	C	A	5: 63,897,946		probably null	Het
1110037F02Rik	T	A	4: 11,542,128	D1521E	probably benign	Het
Amph	A	G	13: 19,094,837	K161E	probably benign	Het
Areg	A	G	5: 91,143,633	N145S	probably damaging	Het
Arhgap29	C	T	3: 121,988,573	T142I	probably damaging	Het
Bcar3	C	T	3: 122,511,156		probably benign	Het
Brpf3	C	T	17: 28,806,274	A107V	probably benign	Het
Btnl2	T	A	17: 34,368,708	S509T	possibly damaging	Het
Cacna2d2	A	G	9: 107,525,454		probably null	Het
Casz1	C	T	4: 148,944,431	P1111L	probably damaging	Het
Ccdc91	C	T	6: 147,631,588	T411I	unknown	Het
Chd9	A	C	8: 91,041,141	E2422A	probably damaging	Het
Clrn3	T	C	7: 135,528,404	I34V	probably benign	Het
Cnksr3	C	T	10: 7,154,467	D79N	probably damaging	Het
Cops8	A	G	1: 90,612,007		probably null	Het
Cpa2	A	G	6: 30,564,346	K392R	probably benign	Het
Dnajc28	G	A	16: 91,616,907	R150*	probably null	Het
Dnase1l3	T	C	14: 7,994,299		probably benign	Het
Fam65a	C	A	8: 105,620,888	L1028M	unknown	Het
Gdpd5	A	T	7: 99,456,482	T502S	probably benign	Het
Gp2	A	T	7: 119,450,152	D387E	probably damaging	Het
Gpr179	A	G	11: 97,351,538	L160P	probably benign	Het
Hmcn1	G	A	1: 150,646,658	T3497M	probably benign	Het
Idh3b	T	A	2: 130,280,500	T322S	possibly damaging	Het
Kit	A	T	5: 75,620,880	N323I	possibly damaging	Het
Kng2	T	C	16: 22,987,496	S445G	unknown	Het
Lin54	A	G	5: 100,454,499	V393A	probably benign	Het
Lyst	T	A	13: 13,698,360	W2715R	probably damaging	Het
Mad1l1	T	C	5: 140,315,058	T28A	probably benign	Het
Med7	T	A	11: 46,441,246	C223S	probably benign	Het
Megf8	T	A	7: 25,353,873	L1823Q	probably damaging	Het
Mga	C	A	2: 119,947,238	Q1755K	probably benign	Het
Mgat4b	A	T	11: 50,210,974	N22I	probably benign	Het
Ndufb6	C	T	4: 40,270,665		probably null	Het
Neil3	A	G	8: 53,589,094	L490P	probably benign	Het
Nek9	C	T	12: 85,303,643	V886I	probably benign	Het
Nol4l	A	T	2: 153,420,553	Y366*	probably null	Het
Nt5dc2	A	G	14: 31,138,929	T354A	probably damaging	Het
Olfr339	T	A	2: 36,421,703	Y102N	probably damaging	Het
Pde2a	G	A	7: 101,500,448		probably null	Het
Phf1	T	C	17: 26,937,070	F444L	possibly damaging	Het
Plin4	G	A	17: 56,107,019	T202I	possibly damaging	Het
Plk4	G	C	3: 40,813,574	V851L	probably damaging	Het
Pp2d1	A	G	17: 53,515,229	S270P	probably damaging	Het
Scn9a	A	G	2: 66,540,530	F569L	probably damaging	Het
Sel1l2	T	A	2: 140,262,706	L306F	probably damaging	Het
Spic	A	T	10: 88,677,566	S86T	probably damaging	Het
Stkld1	A	G	2: 26,946,656	N278S	probably benign	Het
Taar7d	T	A	10: 24,027,597	F126I	probably benign	Het
Tbc1d31	A	G	15: 57,960,949	E869G	possibly damaging	Het
Tbcd	C	T	11: 121,493,885	T315M	probably benign	Het
Terf2	T	C	8: 107,083,024	K221E	possibly damaging	Het
Tex43	T	A	18: 56,589,475		probably benign	Het
Thsd7a	T	A	6: 12,468,963	T539S		Het
Tll2	A	G	19: 41,088,874	F818L	possibly damaging	Het
Tmem87a	T	C	2: 120,370,478	T427A	possibly damaging	Het
Ush2a	C	A	1: 188,451,755	Q1419K	possibly damaging	Het
Vill	T	A	9: 119,066,753	F511Y	probably damaging	Het
Vps13c	A	G	9: 67,858,790	D63G	probably benign	Het
Vrk2	A	G	11: 26,535,575	F138L	probably benign	Het
Zfp710	T	C	7: 80,086,027	I514T	probably damaging	Het
Zgrf1	T	A	3: 127,563,383	F753I	possibly damaging	Het

Other mutations in Aox2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Aox2	APN	1	58322801	missense	possibly damaging	0.73
IGL01288:Aox2	APN	1	58294407	missense	probably damaging	0.99
IGL01383:Aox2	APN	1	58294305	missense	probably benign	0.09
IGL01734:Aox2	APN	1	58354310	missense	possibly damaging	0.95
IGL01793:Aox2	APN	1	58336624	missense	possibly damaging	0.79
IGL01834:Aox2	APN	1	58309024	missense	possibly damaging	0.90
IGL01924:Aox2	APN	1	58287743	missense	possibly damaging	0.90
IGL02591:Aox2	APN	1	58358999	nonsense	probably null
IGL02645:Aox2	APN	1	58334724	missense	probably damaging	1.00
IGL02710:Aox2	APN	1	58334769	critical splice donor site	probably null
IGL02801:Aox2	APN	1	58354177	missense	probably damaging	1.00
IGL02988:Aox2	APN	1	58337350	missense	probably benign
IGL03104:Aox2	APN	1	58282759	missense	probably benign
IGL03121:Aox2	APN	1	58358954	missense	probably damaging	1.00
IGL03191:Aox2	APN	1	58359069	missense	probably null	0.98
IGL03236:Aox2	APN	1	58309997	nonsense	probably null
IGL03409:Aox2	APN	1	58354429	missense	possibly damaging	0.91
PIT4362001:Aox2	UTSW	1	58282680	missense	probably damaging	1.00
R0035:Aox2	UTSW	1	58354422	missense	probably benign	0.00
R0035:Aox2	UTSW	1	58354422	missense	probably benign	0.00
R0267:Aox2	UTSW	1	58339446	splice site	probably benign
R0388:Aox2	UTSW	1	58354406	missense	probably damaging	1.00
R0409:Aox2	UTSW	1	58336624	missense	possibly damaging	0.90
R0547:Aox2	UTSW	1	58310042	missense	probably damaging	0.96
R0630:Aox2	UTSW	1	58337321	splice site	probably benign
R0726:Aox2	UTSW	1	58334782	splice site	probably benign
R0734:Aox2	UTSW	1	58305341	missense	probably benign	0.22
R0831:Aox2	UTSW	1	58339683	missense	probably benign	0.28
R0961:Aox2	UTSW	1	58310071	missense	probably benign	0.00
R1404:Aox2	UTSW	1	58346212	splice site	probably benign
R1512:Aox2	UTSW	1	58307351	missense	probably benign	0.00
R1573:Aox2	UTSW	1	58309027	missense	probably benign	0.00
R1592:Aox2	UTSW	1	58300694	missense	probably benign	0.00
R1747:Aox2	UTSW	1	58339592	missense	probably benign	0.01
R1768:Aox2	UTSW	1	58354195	missense	probably benign	0.00
R1809:Aox2	UTSW	1	58294325	missense	probably benign
R1823:Aox2	UTSW	1	58312359	missense	probably benign	0.02
R1834:Aox2	UTSW	1	58308991	missense	probably benign	0.08
R1835:Aox2	UTSW	1	58308991	missense	probably benign	0.08
R1836:Aox2	UTSW	1	58308991	missense	probably benign	0.08
R2219:Aox2	UTSW	1	58349130	splice site	probably null
R2220:Aox2	UTSW	1	58349130	splice site	probably null
R2508:Aox2	UTSW	1	58343673	missense	probably benign	0.38
R2942:Aox2	UTSW	1	58337381	missense	probably benign	0.03
R2967:Aox2	UTSW	1	58322834	missense	probably damaging	0.96
R3082:Aox2	UTSW	1	58283600	splice site	probably benign
R3161:Aox2	UTSW	1	58304438	missense	possibly damaging	0.91
R3408:Aox2	UTSW	1	58343668	missense	probably benign	0.32
R3803:Aox2	UTSW	1	58289899	splice site	probably null
R3894:Aox2	UTSW	1	58334678	critical splice acceptor site	probably null
R4214:Aox2	UTSW	1	58307444	critical splice donor site	probably null
R4249:Aox2	UTSW	1	58299819	missense	probably benign	0.01
R4666:Aox2	UTSW	1	58304597	nonsense	probably null
R4668:Aox2	UTSW	1	58334694	missense	possibly damaging	0.63
R4703:Aox2	UTSW	1	58358957	missense	possibly damaging	0.78
R4758:Aox2	UTSW	1	58332582	missense	probably benign	0.00
R4890:Aox2	UTSW	1	58334703	missense	probably benign	0.11
R4900:Aox2	UTSW	1	58305385	missense	probably benign
R4924:Aox2	UTSW	1	58305344	missense	probably damaging	1.00
R4970:Aox2	UTSW	1	58310095	splice site	probably null
R5112:Aox2	UTSW	1	58310095	splice site	probably null
R5987:Aox2	UTSW	1	58307359	missense	probably benign	0.00
R6239:Aox2	UTSW	1	58305391	critical splice donor site	probably null
R6273:Aox2	UTSW	1	58339672	missense	probably benign	0.00
R6291:Aox2	UTSW	1	58330806	missense	probably damaging	0.98
R6334:Aox2	UTSW	1	58307407	nonsense	probably null
R6764:Aox2	UTSW	1	58350282	missense	probably damaging	0.97
R6766:Aox2	UTSW	1	58349068	missense	possibly damaging	0.95
R6789:Aox2	UTSW	1	58304485	missense	probably benign	0.01
R6804:Aox2	UTSW	1	58304598	missense	probably benign	0.04
R7007:Aox2	UTSW	1	58330892	missense	probably damaging	1.00
R7015:Aox2	UTSW	1	58282758	missense	probably benign	0.00
R7055:Aox2	UTSW	1	58299768	missense	probably benign	0.08
R7089:Aox2	UTSW	1	58336649	missense	probably benign	0.01
R7157:Aox2	UTSW	1	58283492	missense	probably benign	0.00
R7303:Aox2	UTSW	1	58334765	nonsense	probably null
R7426:Aox2	UTSW	1	58289983	nonsense	probably null
R7762:Aox2	UTSW	1	58349104	missense	probably damaging	1.00
R7899:Aox2	UTSW	1	58281237	splice site	probably null
R7942:Aox2	UTSW	1	58337431	missense	probably damaging	1.00
R7975:Aox2	UTSW	1	58309028	missense	probably benign	0.02
R8029:Aox2	UTSW	1	58343668	missense	probably benign	0.32
R8032:Aox2	UTSW	1	58350283	missense	probably benign	0.01
R8147:Aox2	UTSW	1	58300662	missense	probably benign	0.02
R8326:Aox2	UTSW	1	58295887	missense	probably benign
R8770:Aox2	UTSW	1	58339604	missense	probably benign	0.10
R8973:Aox2	UTSW	1	58289954	missense	probably benign	0.34
R9015:Aox2	UTSW	1	58343692	missense	probably damaging	1.00
R9097:Aox2	UTSW	1	58287728	missense	possibly damaging	0.82
R9101:Aox2	UTSW	1	58332637	missense	probably benign	0.03
R9108:Aox2	UTSW	1	58282692	missense	probably damaging	1.00
R9180:Aox2	UTSW	1	58339618	nonsense	probably null
R9258:Aox2	UTSW	1	58312356	missense	probably damaging	1.00
R9293:Aox2	UTSW	1	58322794	missense	possibly damaging	0.86
R9519:Aox2	UTSW	1	58334767	missense	probably damaging	0.98
R9581:Aox2	UTSW	1	58330896	critical splice donor site	probably null
Z1177:Aox2	UTSW	1	58354397	missense	possibly damaging	0.69

Predicted Primers

PCR Primer
(F):5'- CTGACTCACTCCGATGTTTGTG -3'
(R):5'- TTGGTCGGCATTTAAAGCTTGC -3'

Sequencing Primer
(F):5'- TCCGATGTTTGTGACCCACGG -3'
(R):5'- AAGCTTGCTTTAATTTGGCCCAG -3'

Posted On

2020-07-13