Mutagenetix > Incidental Mutations

Incidental Mutation 'R8165:Scn9a'

633699

Institutional Source

Beutler Lab

Gene Symbol

Scn9a

Ensembl Gene

ENSMUSG00000075316

Gene Name

sodium channel, voltage-gated, type IX, alpha

Synonyms

PN1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8165 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

66480080-66634962 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 66540530 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 569 (F569L)

Ref Sequence

ENSEMBL: ENSMUSP00000097642 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100063] [ENSMUST00000100064] [ENSMUST00000112354] [ENSMUST00000164384] [ENSMUST00000169900]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000100063
AA Change: F571L

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000097641
Gene: ENSMUSG00000075316
AA Change: F571L

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	154	403	9.5e-78	PFAM
coiled coil region	404	442	N/A	INTRINSIC
Pfam:DUF3451	465	685	1.3e-62	PFAM
Pfam:Ion_trans	768	957	9.9e-48	PFAM
Pfam:Na_trans_assoc	972	1191	2.9e-72	PFAM
low complexity region	1203	1214	N/A	INTRINSIC
Pfam:Ion_trans	1217	1445	2.8e-55	PFAM
PDB:1BYY\|A	1447	1499	9e-27	PDB
Pfam:Ion_trans	1538	1748	3.4e-52	PFAM
Pfam:PKD_channel	1599	1755	1.1e-7	PFAM
IQ	1877	1899	1.03e-3	SMART
low complexity region	1956	1972	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000100064
AA Change: F569L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000097642
Gene: ENSMUSG00000075316
AA Change: F569L

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	125	412	2.2e-84	PFAM
low complexity region	433	446	N/A	INTRINSIC
Pfam:Na_trans_cytopl	483	693	7.5e-76	PFAM
Pfam:Ion_trans	742	977	4.1e-57	PFAM
Pfam:Na_trans_assoc	981	1185	1.4e-58	PFAM
Pfam:Ion_trans	1189	1466	7e-67	PFAM
Pfam:Ion_trans	1512	1769	1e-55	PFAM
Pfam:PKD_channel	1605	1763	2.6e-7	PFAM
IQ	1886	1908	1.03e-3	SMART
low complexity region	1965	1981	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112354
AA Change: F569L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000107973
Gene: ENSMUSG00000075316
AA Change: F569L

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	154	401	1.2e-77	PFAM
coiled coil region	402	449	N/A	INTRINSIC
Pfam:DUF3451	463	683	1.3e-62	PFAM
Pfam:Ion_trans	766	955	9.9e-48	PFAM
Pfam:Na_trans_assoc	970	1189	2.9e-72	PFAM
low complexity region	1201	1212	N/A	INTRINSIC
Pfam:Ion_trans	1215	1443	2.8e-55	PFAM
PDB:1BYY\|A	1445	1497	7e-29	PDB
Pfam:Ion_trans	1536	1746	3.4e-52	PFAM
Pfam:PKD_channel	1597	1753	1.1e-7	PFAM
IQ	1875	1897	1.03e-3	SMART
low complexity region	1954	1970	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000164384
AA Change: F569L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000126528
Gene: ENSMUSG00000075316
AA Change: F569L

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	154	401	1.1e-77	PFAM
coiled coil region	402	449	N/A	INTRINSIC
Pfam:DUF3451	463	694	4.2e-66	PFAM
Pfam:Ion_trans	777	966	8.8e-48	PFAM
Pfam:Na_trans_assoc	981	1200	6e-72	PFAM
low complexity region	1212	1223	N/A	INTRINSIC
Pfam:Ion_trans	1226	1454	2.5e-55	PFAM
PDB:1BYY\|A	1456	1508	6e-29	PDB
Pfam:Ion_trans	1547	1757	3e-52	PFAM
Pfam:PKD_channel	1608	1764	8.1e-8	PFAM
IQ	1886	1908	1.03e-3	SMART
low complexity region	1965	1981	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169900
AA Change: F569L

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000131711
Gene: ENSMUSG00000075316
AA Change: F569L

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	154	401	3.7e-78	PFAM
coiled coil region	402	449	N/A	INTRINSIC
Pfam:DUF3451	463	683	1.3e-62	PFAM
Pfam:Ion_trans	766	955	9.9e-48	PFAM
Pfam:Na_trans_assoc	970	1189	2.9e-72	PFAM
low complexity region	1201	1212	N/A	INTRINSIC
Pfam:Ion_trans	1215	1443	2.8e-55	PFAM
PDB:1BYY\|A	1445	1497	7e-29	PDB
Pfam:Ion_trans	1536	1746	3.4e-52	PFAM
Pfam:PKD_channel	1597	1753	1.1e-7	PFAM
IQ	1875	1897	1.03e-3	SMART
low complexity region	1954	1970	N/A	INTRINSIC

Meta Mutation Damage Score

0.1393

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated sodium channel which plays a significant role in nociception signaling. Mutations in this gene have been associated with primary erythermalgia, channelopathy-associated insensitivity to pain, and paroxysmal extreme pain disorder. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal/neonatal lethality. Mice homozygous for a knock-in allele exhibit increased susceptibility to electrically induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	C	A	5: 63,897,946		probably null	Het
1110037F02Rik	T	A	4: 11,542,128	D1521E	probably benign	Het
Amph	A	G	13: 19,094,837	K161E	probably benign	Het
Aox2	A	T	1: 58,308,929	H602L	probably benign	Het
Areg	A	G	5: 91,143,633	N145S	probably damaging	Het
Arhgap29	C	T	3: 121,988,573	T142I	probably damaging	Het
Bcar3	C	T	3: 122,511,156		probably benign	Het
Brpf3	C	T	17: 28,806,274	A107V	probably benign	Het
Btnl2	T	A	17: 34,368,708	S509T	possibly damaging	Het
Cacna2d2	A	G	9: 107,525,454		probably null	Het
Casz1	C	T	4: 148,944,431	P1111L	probably damaging	Het
Ccdc91	C	T	6: 147,631,588	T411I	unknown	Het
Chd9	A	C	8: 91,041,141	E2422A	probably damaging	Het
Clrn3	T	C	7: 135,528,404	I34V	probably benign	Het
Cnksr3	C	T	10: 7,154,467	D79N	probably damaging	Het
Cops8	A	G	1: 90,612,007		probably null	Het
Cpa2	A	G	6: 30,564,346	K392R	probably benign	Het
Dnajc28	G	A	16: 91,616,907	R150*	probably null	Het
Dnase1l3	T	C	14: 7,994,299		probably benign	Het
Fam65a	C	A	8: 105,620,888	L1028M	unknown	Het
Gdpd5	A	T	7: 99,456,482	T502S	probably benign	Het
Gp2	A	T	7: 119,450,152	D387E	probably damaging	Het
Gpr179	A	G	11: 97,351,538	L160P	probably benign	Het
Hmcn1	G	A	1: 150,646,658	T3497M	probably benign	Het
Idh3b	T	A	2: 130,280,500	T322S	possibly damaging	Het
Kit	A	T	5: 75,620,880	N323I	possibly damaging	Het
Kng2	T	C	16: 22,987,496	S445G	unknown	Het
Lin54	A	G	5: 100,454,499	V393A	probably benign	Het
Lyst	T	A	13: 13,698,360	W2715R	probably damaging	Het
Mad1l1	T	C	5: 140,315,058	T28A	probably benign	Het
Med7	T	A	11: 46,441,246	C223S	probably benign	Het
Megf8	T	A	7: 25,353,873	L1823Q	probably damaging	Het
Mga	C	A	2: 119,947,238	Q1755K	probably benign	Het
Mgat4b	A	T	11: 50,210,974	N22I	probably benign	Het
Ndufb6	C	T	4: 40,270,665		probably null	Het
Neil3	A	G	8: 53,589,094	L490P	probably benign	Het
Nek9	C	T	12: 85,303,643	V886I	probably benign	Het
Nol4l	A	T	2: 153,420,553	Y366*	probably null	Het
Nt5dc2	A	G	14: 31,138,929	T354A	probably damaging	Het
Olfr339	T	A	2: 36,421,703	Y102N	probably damaging	Het
Pde2a	G	A	7: 101,500,448		probably null	Het
Phf1	T	C	17: 26,937,070	F444L	possibly damaging	Het
Plin4	G	A	17: 56,107,019	T202I	possibly damaging	Het
Plk4	G	C	3: 40,813,574	V851L	probably damaging	Het
Pp2d1	A	G	17: 53,515,229	S270P	probably damaging	Het
Sel1l2	T	A	2: 140,262,706	L306F	probably damaging	Het
Spic	A	T	10: 88,677,566	S86T	probably damaging	Het
Stkld1	A	G	2: 26,946,656	N278S	probably benign	Het
Taar7d	T	A	10: 24,027,597	F126I	probably benign	Het
Tbc1d31	A	G	15: 57,960,949	E869G	possibly damaging	Het
Tbcd	C	T	11: 121,493,885	T315M	probably benign	Het
Terf2	T	C	8: 107,083,024	K221E	possibly damaging	Het
Tex43	T	A	18: 56,589,475		probably benign	Het
Thsd7a	T	A	6: 12,468,963	T539S		Het
Tll2	A	G	19: 41,088,874	F818L	possibly damaging	Het
Tmem87a	T	C	2: 120,370,478	T427A	possibly damaging	Het
Ush2a	C	A	1: 188,451,755	Q1419K	possibly damaging	Het
Vill	T	A	9: 119,066,753	F511Y	probably damaging	Het
Vps13c	A	G	9: 67,858,790	D63G	probably benign	Het
Vrk2	A	G	11: 26,535,575	F138L	probably benign	Het
Zfp710	T	C	7: 80,086,027	I514T	probably damaging	Het
Zgrf1	T	A	3: 127,563,383	F753I	possibly damaging	Het

Other mutations in Scn9a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00514:Scn9a	APN	2	66563601	missense	probably damaging	1.00
IGL00570:Scn9a	APN	2	66484142	missense	probably damaging	1.00
IGL00809:Scn9a	APN	2	66483935	missense	probably damaging	1.00
IGL00977:Scn9a	APN	2	66484301	missense	probably damaging	0.99
IGL01120:Scn9a	APN	2	66526972	missense	probably benign	0.00
IGL01134:Scn9a	APN	2	66504968	missense	probably damaging	1.00
IGL01300:Scn9a	APN	2	66488053	nonsense	probably null
IGL01452:Scn9a	APN	2	66527072	missense	probably damaging	1.00
IGL01531:Scn9a	APN	2	66537378	missense	probably benign	0.11
IGL01572:Scn9a	APN	2	66493886	missense	probably benign	0.00
IGL01645:Scn9a	APN	2	66487642	missense	possibly damaging	0.62
IGL01823:Scn9a	APN	2	66484042	missense	probably damaging	1.00
IGL01965:Scn9a	APN	2	66484433	missense	probably damaging	1.00
IGL02127:Scn9a	APN	2	66547135	missense	probably damaging	1.00
IGL02127:Scn9a	APN	2	66494826	missense	probably damaging	1.00
IGL02166:Scn9a	APN	2	66493103	missense	possibly damaging	0.95
IGL02183:Scn9a	APN	2	66484611	splice site	probably benign
IGL02640:Scn9a	APN	2	66536096	critical splice donor site	probably null
IGL02685:Scn9a	APN	2	66537293	missense	probably damaging	1.00
IGL02798:Scn9a	APN	2	66540559	missense	possibly damaging	0.52
IGL02832:Scn9a	APN	2	66568029	missense	probably damaging	1.00
IGL03008:Scn9a	APN	2	66562511	missense	probably damaging	1.00
IGL03270:Scn9a	APN	2	66484014	missense	probably damaging	1.00
IGL03408:Scn9a	APN	2	66526747	missense	probably benign	0.00
BB007:Scn9a	UTSW	2	66504849	missense	probably damaging	0.99
BB017:Scn9a	UTSW	2	66504849	missense	probably damaging	0.99
R0039:Scn9a	UTSW	2	66562444	missense	probably damaging	0.98
R0173:Scn9a	UTSW	2	66533093	missense	probably damaging	1.00
R0323:Scn9a	UTSW	2	66568131	missense	probably damaging	1.00
R0344:Scn9a	UTSW	2	66505010	missense	probably damaging	0.99
R0421:Scn9a	UTSW	2	66543277	missense	probably benign
R0465:Scn9a	UTSW	2	66526996	missense	probably damaging	1.00
R0514:Scn9a	UTSW	2	66483678	missense	probably damaging	1.00
R0599:Scn9a	UTSW	2	66526799	missense	probably damaging	0.96
R0627:Scn9a	UTSW	2	66537377	missense	probably benign	0.00
R0644:Scn9a	UTSW	2	66533061	critical splice donor site	probably null
R0653:Scn9a	UTSW	2	66533377	missense	probably damaging	1.00
R0685:Scn9a	UTSW	2	66483499	missense	probably benign	0.02
R0718:Scn9a	UTSW	2	66547112	missense	probably damaging	1.00
R0827:Scn9a	UTSW	2	66536124	nonsense	probably null
R0890:Scn9a	UTSW	2	66483735	missense	probably damaging	1.00
R1139:Scn9a	UTSW	2	66504997	missense	probably benign	0.02
R1385:Scn9a	UTSW	2	66563542	missense	probably damaging	1.00
R1398:Scn9a	UTSW	2	66484586	missense	probably benign	0.11
R1496:Scn9a	UTSW	2	66526888	missense	probably benign
R1511:Scn9a	UTSW	2	66526813	missense	probably benign	0.01
R1517:Scn9a	UTSW	2	66505027	splice site	probably benign
R1564:Scn9a	UTSW	2	66484304	missense	probably damaging	1.00
R1634:Scn9a	UTSW	2	66488017	missense	probably damaging	1.00
R1662:Scn9a	UTSW	2	66483459	missense	probably benign	0.00
R1695:Scn9a	UTSW	2	66504876	nonsense	probably null
R1709:Scn9a	UTSW	2	66483506	missense	probably damaging	1.00
R1741:Scn9a	UTSW	2	66487594	missense	probably damaging	0.99
R1755:Scn9a	UTSW	2	66501716	missense	probably benign	0.38
R1914:Scn9a	UTSW	2	66566250	missense	probably damaging	1.00
R1962:Scn9a	UTSW	2	66484311	missense	probably damaging	1.00
R1970:Scn9a	UTSW	2	66515380	missense	probably damaging	0.97
R2017:Scn9a	UTSW	2	66515321	missense	probably damaging	0.99
R2092:Scn9a	UTSW	2	66533376	missense	probably damaging	0.99
R2105:Scn9a	UTSW	2	66568183	missense	probably benign	0.25
R2114:Scn9a	UTSW	2	66484052	missense	probably damaging	1.00
R2115:Scn9a	UTSW	2	66484052	missense	probably damaging	1.00
R2128:Scn9a	UTSW	2	66526654	missense	probably damaging	1.00
R2157:Scn9a	UTSW	2	66536325	missense	probably damaging	1.00
R2162:Scn9a	UTSW	2	66534229	missense	probably damaging	0.98
R2350:Scn9a	UTSW	2	66504968	missense	probably damaging	1.00
R3694:Scn9a	UTSW	2	66562405	missense	probably benign
R3771:Scn9a	UTSW	2	66483648	missense	probably benign	0.26
R3772:Scn9a	UTSW	2	66483648	missense	probably benign	0.26
R3773:Scn9a	UTSW	2	66483648	missense	probably benign	0.26
R3922:Scn9a	UTSW	2	66526873	missense	possibly damaging	0.88
R3926:Scn9a	UTSW	2	66526873	missense	possibly damaging	0.88
R4258:Scn9a	UTSW	2	66565054	intron	probably benign
R4385:Scn9a	UTSW	2	66484556	missense	probably damaging	1.00
R4415:Scn9a	UTSW	2	66526693	missense	probably damaging	1.00
R4570:Scn9a	UTSW	2	66483558	missense	possibly damaging	0.85
R4682:Scn9a	UTSW	2	66547018	missense	probably benign
R4783:Scn9a	UTSW	2	66540623	missense	probably benign	0.01
R4822:Scn9a	UTSW	2	66483749	missense	possibly damaging	0.55
R4829:Scn9a	UTSW	2	66551713	missense	probably benign
R4908:Scn9a	UTSW	2	66526743	missense	probably benign	0.03
R4983:Scn9a	UTSW	2	66566270	missense	probably benign	0.02
R5047:Scn9a	UTSW	2	66562480	missense	probably damaging	1.00
R5100:Scn9a	UTSW	2	66534119	missense	probably damaging	1.00
R5140:Scn9a	UTSW	2	66565167	missense	possibly damaging	0.81
R5398:Scn9a	UTSW	2	66488043	missense	probably damaging	1.00
R5557:Scn9a	UTSW	2	66547103	missense	probably damaging	0.99
R5582:Scn9a	UTSW	2	66565029	intron	probably benign
R6108:Scn9a	UTSW	2	66484049	missense	probably damaging	1.00
R6115:Scn9a	UTSW	2	66563629	missense	possibly damaging	0.70
R6143:Scn9a	UTSW	2	66487524	missense	probably benign	0.00
R6261:Scn9a	UTSW	2	66483896	missense	probably damaging	1.00
R6335:Scn9a	UTSW	2	66568264	start codon destroyed	possibly damaging	0.91
R6429:Scn9a	UTSW	2	66526963	missense	possibly damaging	0.95
R6632:Scn9a	UTSW	2	66483502	missense	probably benign	0.23
R6681:Scn9a	UTSW	2	66563342	missense	possibly damaging	0.90
R6830:Scn9a	UTSW	2	66568029	missense	probably damaging	1.00
R7102:Scn9a	UTSW	2	66549015	missense	probably damaging	1.00
R7186:Scn9a	UTSW	2	66534223	missense	probably damaging	1.00
R7243:Scn9a	UTSW	2	66540530	missense	probably damaging	1.00
R7311:Scn9a	UTSW	2	66484404	missense	possibly damaging	0.54
R7328:Scn9a	UTSW	2	66484587	missense	probably benign
R7386:Scn9a	UTSW	2	66540550	missense	probably damaging	1.00
R7438:Scn9a	UTSW	2	66547187	missense	possibly damaging	0.81
R7483:Scn9a	UTSW	2	66533348	missense	probably damaging	0.99
R7485:Scn9a	UTSW	2	66534217	missense	probably damaging	1.00
R7526:Scn9a	UTSW	2	66483646	missense	probably benign
R7617:Scn9a	UTSW	2	66540549	missense	possibly damaging	0.55
R7642:Scn9a	UTSW	2	66536236	missense	probably benign	0.02
R7653:Scn9a	UTSW	2	66527080	missense	probably damaging	1.00
R7747:Scn9a	UTSW	2	66484298	missense	probably damaging	1.00
R7823:Scn9a	UTSW	2	66483791	missense	probably damaging	1.00
R7864:Scn9a	UTSW	2	66484560	missense	possibly damaging	0.73
R7890:Scn9a	UTSW	2	66543112	missense	probably benign	0.00
R7930:Scn9a	UTSW	2	66504849	missense	probably damaging	0.99
R7975:Scn9a	UTSW	2	66484253	missense	probably damaging	1.00
R8057:Scn9a	UTSW	2	66515430	missense	probably benign	0.06
R8145:Scn9a	UTSW	2	66487410	missense	probably damaging	1.00
R8163:Scn9a	UTSW	2	66484401	missense	probably damaging	1.00
R8342:Scn9a	UTSW	2	66536282	missense	probably benign
R8345:Scn9a	UTSW	2	66494622	missense	probably damaging	0.96
X0003:Scn9a	UTSW	2	66508647	missense	probably benign	0.02
X0062:Scn9a	UTSW	2	66568077	missense	probably damaging	1.00
Z1176:Scn9a	UTSW	2	66540592	missense	probably benign	0.00
Z1177:Scn9a	UTSW	2	66494685	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- AGGGTCCATCAACAAGCGAC -3'
(R):5'- CAAACACGAGATCACTGGGCTC -3'

Sequencing Primer
(F):5'- GACACCACGCCATTGCAGTC -3'
(R):5'- AGTGGTTATTTCATGAAGTCTGTTC -3'

Posted On

2020-07-13