Incidental Mutation 'R8165:Plk4'
ID633705
Institutional Source Beutler Lab
Gene Symbol Plk4
Ensembl Gene ENSMUSG00000025758
Gene Namepolo like kinase 4
SynonymsStk18, Sak
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8165 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location40800019-40816883 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 40813574 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 851 (V851L)
Ref Sequence ENSEMBL: ENSMUSP00000026858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026858] [ENSMUST00000026859] [ENSMUST00000167556] [ENSMUST00000203295] [ENSMUST00000203895] [ENSMUST00000204032]
PDB Structure
Murine Sak Polo Domain [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000026858
AA Change: V851L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000026858
Gene: ENSMUSG00000025758
AA Change: V851L

DomainStartEndE-ValueType
S_TKc 12 265 3.46e-100 SMART
low complexity region 288 312 N/A INTRINSIC
low complexity region 329 341 N/A INTRINSIC
PDB:4G7N|B 554 774 6e-41 PDB
low complexity region 820 831 N/A INTRINSIC
Pfam:POLO_box 849 910 7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026859
SMART Domains Protein: ENSMUSP00000026859
Gene: ENSMUSG00000025759

DomainStartEndE-ValueType
Pfam:Sugar_tr 31 235 3.6e-13 PFAM
Pfam:MFS_1 43 387 4.2e-31 PFAM
transmembrane domain 417 439 N/A INTRINSIC
transmembrane domain 452 474 N/A INTRINSIC
transmembrane domain 484 503 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167556
AA Change: V848L

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126945
Gene: ENSMUSG00000025758
AA Change: V848L

DomainStartEndE-ValueType
S_TKc 12 265 3.46e-100 SMART
low complexity region 288 312 N/A INTRINSIC
low complexity region 329 341 N/A INTRINSIC
PDB:4G7N|B 551 771 6e-41 PDB
low complexity region 817 828 N/A INTRINSIC
Pfam:POLO_box 844 908 1.6e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203295
AA Change: V824L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145277
Gene: ENSMUSG00000025758
AA Change: V824L

DomainStartEndE-ValueType
S_TKc 12 265 3.46e-100 SMART
low complexity region 288 312 N/A INTRINSIC
low complexity region 329 341 N/A INTRINSIC
PDB:4G7N|B 554 747 3e-32 PDB
low complexity region 793 804 N/A INTRINSIC
Pfam:POLO_box 822 883 6.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203895
SMART Domains Protein: ENSMUSP00000145455
Gene: ENSMUSG00000025758

DomainStartEndE-ValueType
STYKc 12 143 3.5e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204032
AA Change: V83L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145201
Gene: ENSMUSG00000025758
AA Change: V83L

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
Pfam:POLO_box 81 142 2.5e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: This gene encodes a member of the polo family of serine/threonine protein kinases. The protein localizes to the nucleolus during G2, to centrosomes during G2/M, and to the cleavage furrow during cytokinesis. It is required for progression through mitosis, cell survival, and embryonic development. The mouse genome contains a pseudogene similar to this gene. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for disruptions of this gene die before birth. Development is arrested around E7.5. Mice heterozygous for an ENU-induced allele or gene trap alele exhibit male hypogonadism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C A 5: 63,897,946 probably null Het
1110037F02Rik T A 4: 11,542,128 D1521E probably benign Het
Amph A G 13: 19,094,837 K161E probably benign Het
Aox2 A T 1: 58,308,929 H602L probably benign Het
Areg A G 5: 91,143,633 N145S probably damaging Het
Arhgap29 C T 3: 121,988,573 T142I probably damaging Het
Bcar3 C T 3: 122,511,156 probably benign Het
Brpf3 C T 17: 28,806,274 A107V probably benign Het
Btnl2 T A 17: 34,368,708 S509T possibly damaging Het
Cacna2d2 A G 9: 107,525,454 probably null Het
Casz1 C T 4: 148,944,431 P1111L probably damaging Het
Ccdc91 C T 6: 147,631,588 T411I unknown Het
Chd9 A C 8: 91,041,141 E2422A probably damaging Het
Clrn3 T C 7: 135,528,404 I34V probably benign Het
Cnksr3 C T 10: 7,154,467 D79N probably damaging Het
Cops8 A G 1: 90,612,007 probably null Het
Cpa2 A G 6: 30,564,346 K392R probably benign Het
Dnajc28 G A 16: 91,616,907 R150* probably null Het
Dnase1l3 T C 14: 7,994,299 probably benign Het
Fam65a C A 8: 105,620,888 L1028M unknown Het
Gdpd5 A T 7: 99,456,482 T502S probably benign Het
Gp2 A T 7: 119,450,152 D387E probably damaging Het
Gpr179 A G 11: 97,351,538 L160P probably benign Het
Hmcn1 G A 1: 150,646,658 T3497M probably benign Het
Idh3b T A 2: 130,280,500 T322S possibly damaging Het
Kit A T 5: 75,620,880 N323I possibly damaging Het
Kng2 T C 16: 22,987,496 S445G unknown Het
Lin54 A G 5: 100,454,499 V393A probably benign Het
Lyst T A 13: 13,698,360 W2715R probably damaging Het
Mad1l1 T C 5: 140,315,058 T28A probably benign Het
Med7 T A 11: 46,441,246 C223S probably benign Het
Megf8 T A 7: 25,353,873 L1823Q probably damaging Het
Mga C A 2: 119,947,238 Q1755K probably benign Het
Mgat4b A T 11: 50,210,974 N22I probably benign Het
Ndufb6 C T 4: 40,270,665 probably null Het
Neil3 A G 8: 53,589,094 L490P probably benign Het
Nek9 C T 12: 85,303,643 V886I probably benign Het
Nol4l A T 2: 153,420,553 Y366* probably null Het
Nt5dc2 A G 14: 31,138,929 T354A probably damaging Het
Olfr339 T A 2: 36,421,703 Y102N probably damaging Het
Pde2a G A 7: 101,500,448 probably null Het
Phf1 T C 17: 26,937,070 F444L possibly damaging Het
Plin4 G A 17: 56,107,019 T202I possibly damaging Het
Pp2d1 A G 17: 53,515,229 S270P probably damaging Het
Scn9a A G 2: 66,540,530 F569L probably damaging Het
Sel1l2 T A 2: 140,262,706 L306F probably damaging Het
Spic A T 10: 88,677,566 S86T probably damaging Het
Stkld1 A G 2: 26,946,656 N278S probably benign Het
Taar7d T A 10: 24,027,597 F126I probably benign Het
Tbc1d31 A G 15: 57,960,949 E869G possibly damaging Het
Tbcd C T 11: 121,493,885 T315M probably benign Het
Terf2 T C 8: 107,083,024 K221E possibly damaging Het
Tex43 T A 18: 56,589,475 probably benign Het
Thsd7a T A 6: 12,468,963 T539S Het
Tll2 A G 19: 41,088,874 F818L possibly damaging Het
Tmem87a T C 2: 120,370,478 T427A possibly damaging Het
Ush2a C A 1: 188,451,755 Q1419K possibly damaging Het
Vill T A 9: 119,066,753 F511Y probably damaging Het
Vps13c A G 9: 67,858,790 D63G probably benign Het
Vrk2 A G 11: 26,535,575 F138L probably benign Het
Zfp710 T C 7: 80,086,027 I514T probably damaging Het
Zgrf1 T A 3: 127,563,383 F753I possibly damaging Het
Other mutations in Plk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Plk4 APN 3 40801789 missense probably damaging 1.00
IGL01730:Plk4 APN 3 40805850 missense probably benign 0.00
IGL01906:Plk4 APN 3 40810381 missense probably null 0.01
IGL02021:Plk4 APN 3 40810708 missense probably damaging 0.97
IGL02718:Plk4 APN 3 40815021 missense probably damaging 1.00
IGL03287:Plk4 APN 3 40805118 missense probably benign 0.11
R0058:Plk4 UTSW 3 40805872 missense probably benign
R0058:Plk4 UTSW 3 40805872 missense probably benign
R0312:Plk4 UTSW 3 40813547 missense probably damaging 0.97
R0387:Plk4 UTSW 3 40812884 splice site probably benign
R0411:Plk4 UTSW 3 40811219 unclassified probably benign
R0480:Plk4 UTSW 3 40805640 missense probably benign 0.15
R1170:Plk4 UTSW 3 40801847 missense probably damaging 1.00
R1268:Plk4 UTSW 3 40811369 missense probably damaging 1.00
R1529:Plk4 UTSW 3 40806536 missense probably benign 0.09
R1987:Plk4 UTSW 3 40805817 missense possibly damaging 0.60
R1988:Plk4 UTSW 3 40805817 missense possibly damaging 0.60
R2050:Plk4 UTSW 3 40810380 missense probably benign
R4409:Plk4 UTSW 3 40806549 missense probably damaging 0.98
R4727:Plk4 UTSW 3 40805154 missense probably benign 0.00
R4765:Plk4 UTSW 3 40802022 missense probably damaging 1.00
R4772:Plk4 UTSW 3 40805190 missense probably damaging 1.00
R5022:Plk4 UTSW 3 40802077 splice site probably null
R5363:Plk4 UTSW 3 40801984 missense possibly damaging 0.71
R5651:Plk4 UTSW 3 40813505 missense probably benign 0.00
R5665:Plk4 UTSW 3 40813586 missense possibly damaging 0.79
R5724:Plk4 UTSW 3 40801046 missense probably damaging 1.00
R6391:Plk4 UTSW 3 40808973 missense probably benign 0.05
R6694:Plk4 UTSW 3 40801828 missense probably damaging 1.00
R7412:Plk4 UTSW 3 40812178 missense probably benign
R8047:Plk4 UTSW 3 40805752 missense probably benign
R8399:Plk4 UTSW 3 40808830 nonsense probably null
R8411:Plk4 UTSW 3 40813466 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCATTCGCCAACTTTAGCTAC -3'
(R):5'- GACATCATTCTCTATTCTGCAAAACCC -3'

Sequencing Primer
(F):5'- CAGAAGACATGATTTGGCCTTCC -3'
(R):5'- TTCTGCAAAACCCTTATCATGAC -3'
Posted On2020-07-13