Incidental Mutation 'R8165:Zgrf1'
ID633708
Institutional Source Beutler Lab
Gene Symbol Zgrf1
Ensembl Gene ENSMUSG00000051278
Gene Namezinc finger, GRF-type containing 1
Synonyms4930422G04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R8165 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location127553489-127618023 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127563383 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 753 (F753I)
Ref Sequence ENSEMBL: ENSMUSP00000142886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043108] [ENSMUST00000195955] [ENSMUST00000196141] [ENSMUST00000199888] [ENSMUST00000200490]
Predicted Effect probably benign
Transcript: ENSMUST00000043108
SMART Domains Protein: ENSMUSP00000044432
Gene: ENSMUSG00000051278

DomainStartEndE-ValueType
Pfam:DUF2439 3 81 3.7e-23 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
low complexity region 896 906 N/A INTRINSIC
Pfam:zf-GRF 1109 1153 1.5e-17 PFAM
low complexity region 1316 1328 N/A INTRINSIC
Pfam:AAA_11 1501 1608 1.6e-21 PFAM
Pfam:AAA_12 1616 1802 1.3e-51 PFAM
coiled coil region 1833 1861 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000195955
AA Change: F753I

PolyPhen 2 Score 0.765 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142886
Gene: ENSMUSG00000051278
AA Change: F753I

DomainStartEndE-ValueType
Pfam:DUF2439 3 82 1.6e-25 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196141
SMART Domains Protein: ENSMUSP00000143761
Gene: ENSMUSG00000051278

DomainStartEndE-ValueType
Pfam:DUF2439 3 81 3.7e-23 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
low complexity region 896 906 N/A INTRINSIC
Pfam:zf-GRF 1109 1153 1.5e-17 PFAM
low complexity region 1316 1328 N/A INTRINSIC
Pfam:AAA_11 1501 1608 1.6e-21 PFAM
Pfam:AAA_12 1616 1802 1.3e-51 PFAM
coiled coil region 1833 1861 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199888
SMART Domains Protein: ENSMUSP00000142693
Gene: ENSMUSG00000051278

DomainStartEndE-ValueType
Pfam:DUF2439 3 82 3.5e-22 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200490
SMART Domains Protein: ENSMUSP00000143585
Gene: ENSMUSG00000051278

DomainStartEndE-ValueType
Pfam:DUF2439 3 81 3.4e-20 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C A 5: 63,897,946 probably null Het
1110037F02Rik T A 4: 11,542,128 D1521E probably benign Het
Amph A G 13: 19,094,837 K161E probably benign Het
Aox2 A T 1: 58,308,929 H602L probably benign Het
Areg A G 5: 91,143,633 N145S probably damaging Het
Arhgap29 C T 3: 121,988,573 T142I probably damaging Het
Bcar3 C T 3: 122,511,156 probably benign Het
Brpf3 C T 17: 28,806,274 A107V probably benign Het
Btnl2 T A 17: 34,368,708 S509T possibly damaging Het
Cacna2d2 A G 9: 107,525,454 probably null Het
Casz1 C T 4: 148,944,431 P1111L probably damaging Het
Ccdc91 C T 6: 147,631,588 T411I unknown Het
Chd9 A C 8: 91,041,141 E2422A probably damaging Het
Clrn3 T C 7: 135,528,404 I34V probably benign Het
Cnksr3 C T 10: 7,154,467 D79N probably damaging Het
Cops8 A G 1: 90,612,007 probably null Het
Cpa2 A G 6: 30,564,346 K392R probably benign Het
Dnajc28 G A 16: 91,616,907 R150* probably null Het
Dnase1l3 T C 14: 7,994,299 probably benign Het
Fam65a C A 8: 105,620,888 L1028M unknown Het
Gdpd5 A T 7: 99,456,482 T502S probably benign Het
Gp2 A T 7: 119,450,152 D387E probably damaging Het
Gpr179 A G 11: 97,351,538 L160P probably benign Het
Hmcn1 G A 1: 150,646,658 T3497M probably benign Het
Idh3b T A 2: 130,280,500 T322S possibly damaging Het
Kit A T 5: 75,620,880 N323I possibly damaging Het
Kng2 T C 16: 22,987,496 S445G unknown Het
Lin54 A G 5: 100,454,499 V393A probably benign Het
Lyst T A 13: 13,698,360 W2715R probably damaging Het
Mad1l1 T C 5: 140,315,058 T28A probably benign Het
Med7 T A 11: 46,441,246 C223S probably benign Het
Megf8 T A 7: 25,353,873 L1823Q probably damaging Het
Mga C A 2: 119,947,238 Q1755K probably benign Het
Mgat4b A T 11: 50,210,974 N22I probably benign Het
Ndufb6 C T 4: 40,270,665 probably null Het
Neil3 A G 8: 53,589,094 L490P probably benign Het
Nek9 C T 12: 85,303,643 V886I probably benign Het
Nol4l A T 2: 153,420,553 Y366* probably null Het
Nt5dc2 A G 14: 31,138,929 T354A probably damaging Het
Olfr339 T A 2: 36,421,703 Y102N probably damaging Het
Pde2a G A 7: 101,500,448 probably null Het
Phf1 T C 17: 26,937,070 F444L possibly damaging Het
Plin4 G A 17: 56,107,019 T202I possibly damaging Het
Plk4 G C 3: 40,813,574 V851L probably damaging Het
Pp2d1 A G 17: 53,515,229 S270P probably damaging Het
Scn9a A G 2: 66,540,530 F569L probably damaging Het
Sel1l2 T A 2: 140,262,706 L306F probably damaging Het
Spic A T 10: 88,677,566 S86T probably damaging Het
Stkld1 A G 2: 26,946,656 N278S probably benign Het
Taar7d T A 10: 24,027,597 F126I probably benign Het
Tbc1d31 A G 15: 57,960,949 E869G possibly damaging Het
Tbcd C T 11: 121,493,885 T315M probably benign Het
Terf2 T C 8: 107,083,024 K221E possibly damaging Het
Tex43 T A 18: 56,589,475 probably benign Het
Thsd7a T A 6: 12,468,963 T539S Het
Tll2 A G 19: 41,088,874 F818L possibly damaging Het
Tmem87a T C 2: 120,370,478 T427A possibly damaging Het
Ush2a C A 1: 188,451,755 Q1419K possibly damaging Het
Vill T A 9: 119,066,753 F511Y probably damaging Het
Vps13c A G 9: 67,858,790 D63G probably benign Het
Vrk2 A G 11: 26,535,575 F138L probably benign Het
Zfp710 T C 7: 80,086,027 I514T probably damaging Het
Other mutations in Zgrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Zgrf1 APN 3 127588141 splice site probably benign
IGL01153:Zgrf1 APN 3 127602406 missense probably damaging 1.00
IGL01330:Zgrf1 APN 3 127584007 missense probably damaging 1.00
IGL01501:Zgrf1 APN 3 127602562 splice site probably null
IGL01827:Zgrf1 APN 3 127616281 missense probably benign 0.06
IGL02600:Zgrf1 APN 3 127600974 splice site probably benign
IGL03122:Zgrf1 APN 3 127588133 missense possibly damaging 0.91
IGL03365:Zgrf1 APN 3 127598774 missense possibly damaging 0.48
R0015:Zgrf1 UTSW 3 127555397 splice site probably benign
R0243:Zgrf1 UTSW 3 127615446 missense probably damaging 0.99
R0468:Zgrf1 UTSW 3 127562041 missense possibly damaging 0.72
R0497:Zgrf1 UTSW 3 127584650 splice site probably benign
R0505:Zgrf1 UTSW 3 127573238 missense probably benign 0.30
R0511:Zgrf1 UTSW 3 127584660 missense possibly damaging 0.93
R0539:Zgrf1 UTSW 3 127615192 missense probably damaging 1.00
R0617:Zgrf1 UTSW 3 127588038 missense probably benign 0.39
R1298:Zgrf1 UTSW 3 127583889 missense possibly damaging 0.95
R1353:Zgrf1 UTSW 3 127611803 missense probably damaging 1.00
R1593:Zgrf1 UTSW 3 127561026 missense possibly damaging 0.86
R1846:Zgrf1 UTSW 3 127615463 missense probably damaging 1.00
R1912:Zgrf1 UTSW 3 127563137 missense probably benign
R2062:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2064:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2065:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2066:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2067:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2256:Zgrf1 UTSW 3 127561997 missense probably benign 0.18
R2321:Zgrf1 UTSW 3 127562407 nonsense probably null
R2381:Zgrf1 UTSW 3 127556214 missense probably benign 0.02
R2913:Zgrf1 UTSW 3 127598707 missense possibly damaging 0.65
R3147:Zgrf1 UTSW 3 127584148 missense possibly damaging 0.84
R3236:Zgrf1 UTSW 3 127613375 missense probably damaging 1.00
R3237:Zgrf1 UTSW 3 127613375 missense probably damaging 1.00
R4433:Zgrf1 UTSW 3 127562078 missense probably benign
R4441:Zgrf1 UTSW 3 127586137 missense possibly damaging 0.45
R4457:Zgrf1 UTSW 3 127595929 missense probably damaging 1.00
R4498:Zgrf1 UTSW 3 127586100 nonsense probably null
R4598:Zgrf1 UTSW 3 127601030 missense probably benign 0.14
R4701:Zgrf1 UTSW 3 127598704 missense probably benign 0.03
R4898:Zgrf1 UTSW 3 127602436 missense probably damaging 1.00
R4944:Zgrf1 UTSW 3 127561868 nonsense probably null
R5256:Zgrf1 UTSW 3 127602445 missense probably damaging 1.00
R5294:Zgrf1 UTSW 3 127600980 missense probably benign 0.14
R5358:Zgrf1 UTSW 3 127567703 critical splice donor site probably null
R5359:Zgrf1 UTSW 3 127601165 missense possibly damaging 0.95
R5447:Zgrf1 UTSW 3 127563119 missense possibly damaging 0.73
R5569:Zgrf1 UTSW 3 127561025 missense probably benign 0.33
R5887:Zgrf1 UTSW 3 127584765 missense probably damaging 1.00
R5914:Zgrf1 UTSW 3 127561023 missense probably damaging 0.99
R5925:Zgrf1 UTSW 3 127573204 missense possibly damaging 0.84
R5936:Zgrf1 UTSW 3 127562253 missense possibly damaging 0.72
R6087:Zgrf1 UTSW 3 127615486 missense probably damaging 1.00
R6089:Zgrf1 UTSW 3 127595993 missense probably damaging 1.00
R6181:Zgrf1 UTSW 3 127587941 missense probably damaging 1.00
R6277:Zgrf1 UTSW 3 127598812 missense possibly damaging 0.81
R6441:Zgrf1 UTSW 3 127588034 missense possibly damaging 0.93
R6659:Zgrf1 UTSW 3 127616506 missense probably damaging 0.99
R6857:Zgrf1 UTSW 3 127581447 missense probably damaging 0.99
R6932:Zgrf1 UTSW 3 127559632 critical splice donor site probably null
R7008:Zgrf1 UTSW 3 127561772 missense probably benign 0.18
R7175:Zgrf1 UTSW 3 127563590 missense probably damaging 1.00
R7264:Zgrf1 UTSW 3 127563569 missense probably benign 0.00
R7272:Zgrf1 UTSW 3 127598760 missense probably damaging 0.99
R7298:Zgrf1 UTSW 3 127583650 nonsense probably null
R7412:Zgrf1 UTSW 3 127563071 missense probably benign 0.06
R7836:Zgrf1 UTSW 3 127563431 missense probably damaging 0.96
R7945:Zgrf1 UTSW 3 127562760 missense probably benign 0.37
R7996:Zgrf1 UTSW 3 127595924 missense possibly damaging 0.94
R8198:Zgrf1 UTSW 3 127596024 critical splice donor site probably null
R8296:Zgrf1 UTSW 3 127583995 missense probably damaging 0.99
R8298:Zgrf1 UTSW 3 127615229 missense probably damaging 1.00
R8341:Zgrf1 UTSW 3 127560915 nonsense probably null
R8445:Zgrf1 UTSW 3 127586205 critical splice donor site probably null
RF015:Zgrf1 UTSW 3 127563233 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGAACAGTGACCTGCTCTCAG -3'
(R):5'- GCTCAGACTGTGACTTTAAAAGG -3'

Sequencing Primer
(F):5'- TGCTCTCAGAAGGTACCCAG -3'
(R):5'- CAGACTGTGACTTTAAAAGGGACATG -3'
Posted On2020-07-13