Incidental Mutation 'R8165:Areg'
ID633712
Institutional Source Beutler Lab
Gene Symbol Areg
Ensembl Gene ENSMUSG00000029378
Gene Nameamphiregulin
SynonymsAR, Sdgf
MMRRC Submission
Accession Numbers

MGI: 88068; Ncbi RefSeq: NM_009704

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8165 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location91139599-91148432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91143633 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 145 (N145S)
Ref Sequence ENSEMBL: ENSMUSP00000031325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031325]
Predicted Effect probably damaging
Transcript: ENSMUST00000031325
AA Change: N145S

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031325
Gene: ENSMUSG00000029378
AA Change: N145S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EGF 138 175 7.41e0 SMART
transmembrane domain 193 215 N/A INTRINSIC
low complexity region 222 240 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: This gene encodes a member of the epidermal growth factor (EGF) family and preproprotein that is proteolytically processed to generate a mature protein product. The encoded protein is a ligand of the epidermal growth factor receptor (EGFR) and has been shown to play a role in immunity, inflammation, tissue repair, and lung and mammary gland development. Homozygous knockout mice for this gene exhibit impaired immune system regulation in the skin and gene expression changes characteristic of chronic liver damage. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired development of mammary gland ducts in pubescent females. Mutant ducts show retarded elongation with few terminal end buds. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C A 5: 63,897,946 probably null Het
1110037F02Rik T A 4: 11,542,128 D1521E probably benign Het
Amph A G 13: 19,094,837 K161E probably benign Het
Aox2 A T 1: 58,308,929 H602L probably benign Het
Arhgap29 C T 3: 121,988,573 T142I probably damaging Het
Bcar3 C T 3: 122,511,156 probably benign Het
Brpf3 C T 17: 28,806,274 A107V probably benign Het
Btnl2 T A 17: 34,368,708 S509T possibly damaging Het
Cacna2d2 A G 9: 107,525,454 probably null Het
Casz1 C T 4: 148,944,431 P1111L probably damaging Het
Ccdc91 C T 6: 147,631,588 T411I unknown Het
Chd9 A C 8: 91,041,141 E2422A probably damaging Het
Clrn3 T C 7: 135,528,404 I34V probably benign Het
Cnksr3 C T 10: 7,154,467 D79N probably damaging Het
Cops8 A G 1: 90,612,007 probably null Het
Cpa2 A G 6: 30,564,346 K392R probably benign Het
Dnajc28 G A 16: 91,616,907 R150* probably null Het
Dnase1l3 T C 14: 7,994,299 probably benign Het
Fam65a C A 8: 105,620,888 L1028M unknown Het
Gdpd5 A T 7: 99,456,482 T502S probably benign Het
Gp2 A T 7: 119,450,152 D387E probably damaging Het
Gpr179 A G 11: 97,351,538 L160P probably benign Het
Hmcn1 G A 1: 150,646,658 T3497M probably benign Het
Idh3b T A 2: 130,280,500 T322S possibly damaging Het
Kit A T 5: 75,620,880 N323I possibly damaging Het
Kng2 T C 16: 22,987,496 S445G unknown Het
Lin54 A G 5: 100,454,499 V393A probably benign Het
Lyst T A 13: 13,698,360 W2715R probably damaging Het
Mad1l1 T C 5: 140,315,058 T28A probably benign Het
Med7 T A 11: 46,441,246 C223S probably benign Het
Megf8 T A 7: 25,353,873 L1823Q probably damaging Het
Mga C A 2: 119,947,238 Q1755K probably benign Het
Mgat4b A T 11: 50,210,974 N22I probably benign Het
Ndufb6 C T 4: 40,270,665 probably null Het
Neil3 A G 8: 53,589,094 L490P probably benign Het
Nek9 C T 12: 85,303,643 V886I probably benign Het
Nol4l A T 2: 153,420,553 Y366* probably null Het
Nt5dc2 A G 14: 31,138,929 T354A probably damaging Het
Olfr339 T A 2: 36,421,703 Y102N probably damaging Het
Pde2a G A 7: 101,500,448 probably null Het
Phf1 T C 17: 26,937,070 F444L possibly damaging Het
Plin4 G A 17: 56,107,019 T202I possibly damaging Het
Plk4 G C 3: 40,813,574 V851L probably damaging Het
Pp2d1 A G 17: 53,515,229 S270P probably damaging Het
Scn9a A G 2: 66,540,530 F569L probably damaging Het
Sel1l2 T A 2: 140,262,706 L306F probably damaging Het
Spic A T 10: 88,677,566 S86T probably damaging Het
Stkld1 A G 2: 26,946,656 N278S probably benign Het
Taar7d T A 10: 24,027,597 F126I probably benign Het
Tbc1d31 A G 15: 57,960,949 E869G possibly damaging Het
Tbcd C T 11: 121,493,885 T315M probably benign Het
Terf2 T C 8: 107,083,024 K221E possibly damaging Het
Tex43 T A 18: 56,589,475 probably benign Het
Thsd7a T A 6: 12,468,963 T539S Het
Tll2 A G 19: 41,088,874 F818L possibly damaging Het
Tmem87a T C 2: 120,370,478 T427A possibly damaging Het
Ush2a C A 1: 188,451,755 Q1419K possibly damaging Het
Vill T A 9: 119,066,753 F511Y probably damaging Het
Vps13c A G 9: 67,858,790 D63G probably benign Het
Vrk2 A G 11: 26,535,575 F138L probably benign Het
Zfp710 T C 7: 80,086,027 I514T probably damaging Het
Zgrf1 T A 3: 127,563,383 F753I possibly damaging Het
Other mutations in Areg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Areg APN 5 91141095 missense probably damaging 0.99
IGL01929:Areg APN 5 91144453 missense probably benign
IGL01971:Areg APN 5 91141011 missense probably benign 0.03
IGL02250:Areg APN 5 91141108 missense possibly damaging 0.83
R1436:Areg UTSW 5 91139805 start gained probably benign
R1674:Areg UTSW 5 91143626 missense probably damaging 0.96
R1699:Areg UTSW 5 91143498 missense probably damaging 1.00
R4239:Areg UTSW 5 91143516 missense probably damaging 1.00
R4240:Areg UTSW 5 91143516 missense probably damaging 1.00
R4613:Areg UTSW 5 91143504 missense probably benign 0.34
R4738:Areg UTSW 5 91146724 missense possibly damaging 0.91
R5040:Areg UTSW 5 91144339 missense possibly damaging 0.94
R5305:Areg UTSW 5 91144449 missense probably damaging 1.00
R5987:Areg UTSW 5 91146718 missense possibly damaging 0.83
R6075:Areg UTSW 5 91143597 missense probably damaging 0.99
R7210:Areg UTSW 5 91140905 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAACGTGGGCAGTCGTAAATC -3'
(R):5'- GCCATAAAGCTATTTGTTACAGCC -3'

Sequencing Primer
(F):5'- CGTGGGCAGTCGTAAATCTAATC -3'
(R):5'- AGCTATTTGTTACAGCCTTTAAGC -3'
Posted On2020-07-13