Incidental Mutation 'R8165:Vrk2'
ID633733
Institutional Source Beutler Lab
Gene Symbol Vrk2
Ensembl Gene ENSMUSG00000064090
Gene Namevaccinia related kinase 2
Synonyms2810003O05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R8165 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location26471322-26593999 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26535575 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 138 (F138L)
Ref Sequence ENSEMBL: ENSMUSP00000077471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078362] [ENSMUST00000109504]
Predicted Effect probably benign
Transcript: ENSMUST00000078362
AA Change: F138L

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000077471
Gene: ENSMUSG00000064090
AA Change: F138L

DomainStartEndE-ValueType
Pfam:Pkinase 29 298 4.4e-18 PFAM
Pfam:Pkinase_Tyr 29 313 2e-11 PFAM
low complexity region 365 376 N/A INTRINSIC
transmembrane domain 480 502 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109504
AA Change: F138L

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000105130
Gene: ENSMUSG00000064090
AA Change: F138L

DomainStartEndE-ValueType
Pfam:Pkinase 29 302 2.8e-22 PFAM
Pfam:Pkinase_Tyr 29 313 1.3e-11 PFAM
low complexity region 365 376 N/A INTRINSIC
transmembrane domain 480 502 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. The encoded protein acts as an effector of signaling pathways that regulate apoptosis and tumor cell growth. Variants in this gene have been associated with schizophrenia. Alternative splicing results in multiple transcript variants that differ in their subcellular localization and biological activity. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C A 5: 63,897,946 probably null Het
1110037F02Rik T A 4: 11,542,128 D1521E probably benign Het
Amph A G 13: 19,094,837 K161E probably benign Het
Aox2 A T 1: 58,308,929 H602L probably benign Het
Areg A G 5: 91,143,633 N145S probably damaging Het
Arhgap29 C T 3: 121,988,573 T142I probably damaging Het
Bcar3 C T 3: 122,511,156 probably benign Het
Brpf3 C T 17: 28,806,274 A107V probably benign Het
Btnl2 T A 17: 34,368,708 S509T possibly damaging Het
Cacna2d2 A G 9: 107,525,454 probably null Het
Casz1 C T 4: 148,944,431 P1111L probably damaging Het
Ccdc91 C T 6: 147,631,588 T411I unknown Het
Chd9 A C 8: 91,041,141 E2422A probably damaging Het
Clrn3 T C 7: 135,528,404 I34V probably benign Het
Cnksr3 C T 10: 7,154,467 D79N probably damaging Het
Cops8 A G 1: 90,612,007 probably null Het
Cpa2 A G 6: 30,564,346 K392R probably benign Het
Dnajc28 G A 16: 91,616,907 R150* probably null Het
Dnase1l3 T C 14: 7,994,299 probably benign Het
Fam65a C A 8: 105,620,888 L1028M unknown Het
Gdpd5 A T 7: 99,456,482 T502S probably benign Het
Gp2 A T 7: 119,450,152 D387E probably damaging Het
Gpr179 A G 11: 97,351,538 L160P probably benign Het
Hmcn1 G A 1: 150,646,658 T3497M probably benign Het
Idh3b T A 2: 130,280,500 T322S possibly damaging Het
Kit A T 5: 75,620,880 N323I possibly damaging Het
Kng2 T C 16: 22,987,496 S445G unknown Het
Lin54 A G 5: 100,454,499 V393A probably benign Het
Lyst T A 13: 13,698,360 W2715R probably damaging Het
Mad1l1 T C 5: 140,315,058 T28A probably benign Het
Med7 T A 11: 46,441,246 C223S probably benign Het
Megf8 T A 7: 25,353,873 L1823Q probably damaging Het
Mga C A 2: 119,947,238 Q1755K probably benign Het
Mgat4b A T 11: 50,210,974 N22I probably benign Het
Ndufb6 C T 4: 40,270,665 probably null Het
Neil3 A G 8: 53,589,094 L490P probably benign Het
Nek9 C T 12: 85,303,643 V886I probably benign Het
Nol4l A T 2: 153,420,553 Y366* probably null Het
Nt5dc2 A G 14: 31,138,929 T354A probably damaging Het
Olfr339 T A 2: 36,421,703 Y102N probably damaging Het
Pde2a G A 7: 101,500,448 probably null Het
Phf1 T C 17: 26,937,070 F444L possibly damaging Het
Plin4 G A 17: 56,107,019 T202I possibly damaging Het
Plk4 G C 3: 40,813,574 V851L probably damaging Het
Pp2d1 A G 17: 53,515,229 S270P probably damaging Het
Scn9a A G 2: 66,540,530 F569L probably damaging Het
Sel1l2 T A 2: 140,262,706 L306F probably damaging Het
Spic A T 10: 88,677,566 S86T probably damaging Het
Stkld1 A G 2: 26,946,656 N278S probably benign Het
Taar7d T A 10: 24,027,597 F126I probably benign Het
Tbc1d31 A G 15: 57,960,949 E869G possibly damaging Het
Tbcd C T 11: 121,493,885 T315M probably benign Het
Terf2 T C 8: 107,083,024 K221E possibly damaging Het
Tex43 T A 18: 56,589,475 probably benign Het
Thsd7a T A 6: 12,468,963 T539S Het
Tll2 A G 19: 41,088,874 F818L possibly damaging Het
Tmem87a T C 2: 120,370,478 T427A possibly damaging Het
Ush2a C A 1: 188,451,755 Q1419K possibly damaging Het
Vill T A 9: 119,066,753 F511Y probably damaging Het
Vps13c A G 9: 67,858,790 D63G probably benign Het
Zfp710 T C 7: 80,086,027 I514T probably damaging Het
Zgrf1 T A 3: 127,563,383 F753I possibly damaging Het
Other mutations in Vrk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01865:Vrk2 APN 11 26535560 missense possibly damaging 0.73
IGL02011:Vrk2 APN 11 26471717 missense probably benign 0.10
IGL02185:Vrk2 APN 11 26535638 nonsense probably null
IGL02257:Vrk2 APN 11 26534266 missense probably damaging 1.00
IGL02424:Vrk2 APN 11 26476564 missense probably benign 0.00
macromacro UTSW 11 26549325 missense probably damaging 1.00
R0127:Vrk2 UTSW 11 26534313 splice site probably benign
R0184:Vrk2 UTSW 11 26550046 missense probably damaging 0.98
R0670:Vrk2 UTSW 11 26486959 critical splice donor site probably null
R0751:Vrk2 UTSW 11 26483331 splice site probably benign
R0766:Vrk2 UTSW 11 26535522 splice site probably benign
R1103:Vrk2 UTSW 11 26549325 missense probably damaging 1.00
R1184:Vrk2 UTSW 11 26483331 splice site probably benign
R1312:Vrk2 UTSW 11 26535522 splice site probably benign
R2041:Vrk2 UTSW 11 26547914 missense probably benign 0.01
R2857:Vrk2 UTSW 11 26483324 missense possibly damaging 0.54
R2859:Vrk2 UTSW 11 26483324 missense possibly damaging 0.54
R3615:Vrk2 UTSW 11 26489866 missense possibly damaging 0.90
R3616:Vrk2 UTSW 11 26489866 missense possibly damaging 0.90
R4163:Vrk2 UTSW 11 26547915 missense probably benign 0.00
R4651:Vrk2 UTSW 11 26489803 missense probably damaging 0.98
R4652:Vrk2 UTSW 11 26489803 missense probably damaging 0.98
R4662:Vrk2 UTSW 11 26471611 missense possibly damaging 0.95
R5262:Vrk2 UTSW 11 26591697 missense possibly damaging 0.94
R5458:Vrk2 UTSW 11 26498919 missense probably damaging 0.99
R5529:Vrk2 UTSW 11 26499036 missense probably damaging 1.00
R5840:Vrk2 UTSW 11 26534314 splice site probably benign
R5892:Vrk2 UTSW 11 26534372 intron probably benign
R6054:Vrk2 UTSW 11 26486975 missense probably benign 0.20
R6923:Vrk2 UTSW 11 26489893 missense probably damaging 1.00
R6952:Vrk2 UTSW 11 26535597 missense probably damaging 0.97
R7841:Vrk2 UTSW 11 26471457 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTGGTAGCAATAGTCAGC -3'
(R):5'- ACAGCTGCTTAGATGCCTTGG -3'

Sequencing Primer
(F):5'- ACAGCATAGCCTGTCATTGG -3'
(R):5'- AGATGCCTTGGCTATTAGGTAGAAG -3'
Posted On2020-07-13