Incidental Mutation 'R8165:Med7'
ID633734
Institutional Source Beutler Lab
Gene Symbol Med7
Ensembl Gene ENSMUSG00000020397
Gene Namemediator complex subunit 7
SynonymsCrsp33, Crsp9, 1110063B05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R8165 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location46436925-46442721 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46441246 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 223 (C223S)
Ref Sequence ENSEMBL: ENSMUSP00000020665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020665] [ENSMUST00000109231] [ENSMUST00000109232] [ENSMUST00000128940] [ENSMUST00000133635] [ENSMUST00000140027] [ENSMUST00000152119] [ENSMUST00000170928]
Predicted Effect probably benign
Transcript: ENSMUST00000020665
AA Change: C223S

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000020665
Gene: ENSMUSG00000020397
AA Change: C223S

DomainStartEndE-ValueType
Pfam:Med7 6 165 3.9e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109231
SMART Domains Protein: ENSMUSP00000104854
Gene: ENSMUSG00000020397

DomainStartEndE-ValueType
Pfam:Med7 6 165 3.6e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109232
AA Change: C223S

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000104855
Gene: ENSMUSG00000020397
AA Change: C223S

DomainStartEndE-ValueType
Pfam:Med7 6 165 3.9e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128940
SMART Domains Protein: ENSMUSP00000116997
Gene: ENSMUSG00000020397

DomainStartEndE-ValueType
Pfam:Med7 6 157 4.1e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133635
SMART Domains Protein: ENSMUSP00000120617
Gene: ENSMUSG00000020397

DomainStartEndE-ValueType
Pfam:Med7 6 133 2.4e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140027
SMART Domains Protein: ENSMUSP00000120077
Gene: ENSMUSG00000020397

DomainStartEndE-ValueType
Pfam:Med7 6 61 8.6e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152119
SMART Domains Protein: ENSMUSP00000122182
Gene: ENSMUSG00000020397

DomainStartEndE-ValueType
Pfam:Med7 6 93 6.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170928
AA Change: C223S

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000131852
Gene: ENSMUSG00000020397
AA Change: C223S

DomainStartEndE-ValueType
Pfam:Med7 7 164 1.9e-46 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C A 5: 63,897,946 probably null Het
1110037F02Rik T A 4: 11,542,128 D1521E probably benign Het
Amph A G 13: 19,094,837 K161E probably benign Het
Aox2 A T 1: 58,308,929 H602L probably benign Het
Areg A G 5: 91,143,633 N145S probably damaging Het
Arhgap29 C T 3: 121,988,573 T142I probably damaging Het
Bcar3 C T 3: 122,511,156 probably benign Het
Brpf3 C T 17: 28,806,274 A107V probably benign Het
Btnl2 T A 17: 34,368,708 S509T possibly damaging Het
Cacna2d2 A G 9: 107,525,454 probably null Het
Casz1 C T 4: 148,944,431 P1111L probably damaging Het
Ccdc91 C T 6: 147,631,588 T411I unknown Het
Chd9 A C 8: 91,041,141 E2422A probably damaging Het
Clrn3 T C 7: 135,528,404 I34V probably benign Het
Cnksr3 C T 10: 7,154,467 D79N probably damaging Het
Cops8 A G 1: 90,612,007 probably null Het
Cpa2 A G 6: 30,564,346 K392R probably benign Het
Dnajc28 G A 16: 91,616,907 R150* probably null Het
Dnase1l3 T C 14: 7,994,299 probably benign Het
Fam65a C A 8: 105,620,888 L1028M unknown Het
Gdpd5 A T 7: 99,456,482 T502S probably benign Het
Gp2 A T 7: 119,450,152 D387E probably damaging Het
Gpr179 A G 11: 97,351,538 L160P probably benign Het
Hmcn1 G A 1: 150,646,658 T3497M probably benign Het
Idh3b T A 2: 130,280,500 T322S possibly damaging Het
Kit A T 5: 75,620,880 N323I possibly damaging Het
Kng2 T C 16: 22,987,496 S445G unknown Het
Lin54 A G 5: 100,454,499 V393A probably benign Het
Lyst T A 13: 13,698,360 W2715R probably damaging Het
Mad1l1 T C 5: 140,315,058 T28A probably benign Het
Megf8 T A 7: 25,353,873 L1823Q probably damaging Het
Mga C A 2: 119,947,238 Q1755K probably benign Het
Mgat4b A T 11: 50,210,974 N22I probably benign Het
Ndufb6 C T 4: 40,270,665 probably null Het
Neil3 A G 8: 53,589,094 L490P probably benign Het
Nek9 C T 12: 85,303,643 V886I probably benign Het
Nol4l A T 2: 153,420,553 Y366* probably null Het
Nt5dc2 A G 14: 31,138,929 T354A probably damaging Het
Olfr339 T A 2: 36,421,703 Y102N probably damaging Het
Pde2a G A 7: 101,500,448 probably null Het
Phf1 T C 17: 26,937,070 F444L possibly damaging Het
Plin4 G A 17: 56,107,019 T202I possibly damaging Het
Plk4 G C 3: 40,813,574 V851L probably damaging Het
Pp2d1 A G 17: 53,515,229 S270P probably damaging Het
Scn9a A G 2: 66,540,530 F569L probably damaging Het
Sel1l2 T A 2: 140,262,706 L306F probably damaging Het
Spic A T 10: 88,677,566 S86T probably damaging Het
Stkld1 A G 2: 26,946,656 N278S probably benign Het
Taar7d T A 10: 24,027,597 F126I probably benign Het
Tbc1d31 A G 15: 57,960,949 E869G possibly damaging Het
Tbcd C T 11: 121,493,885 T315M probably benign Het
Terf2 T C 8: 107,083,024 K221E possibly damaging Het
Tex43 T A 18: 56,589,475 probably benign Het
Thsd7a T A 6: 12,468,963 T539S Het
Tll2 A G 19: 41,088,874 F818L possibly damaging Het
Tmem87a T C 2: 120,370,478 T427A possibly damaging Het
Ush2a C A 1: 188,451,755 Q1419K possibly damaging Het
Vill T A 9: 119,066,753 F511Y probably damaging Het
Vps13c A G 9: 67,858,790 D63G probably benign Het
Vrk2 A G 11: 26,535,575 F138L probably benign Het
Zfp710 T C 7: 80,086,027 I514T probably damaging Het
Zgrf1 T A 3: 127,563,383 F753I possibly damaging Het
Other mutations in Med7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1257:Med7 UTSW 11 46440633 missense probably damaging 0.96
R1259:Med7 UTSW 11 46440633 missense probably damaging 0.96
R1260:Med7 UTSW 11 46440633 missense probably damaging 0.96
R7216:Med7 UTSW 11 46440854 missense probably damaging 1.00
R7255:Med7 UTSW 11 46440995 missense probably damaging 0.98
R7683:Med7 UTSW 11 46440860 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- GGAACGAGTCATTGAAATGATTCAG -3'
(R):5'- GCAATTACTCAAATATACTTGCTGGCC -3'

Sequencing Primer
(F):5'- ATGATTCAGAATTGCTTGGCTTC -3'
(R):5'- AATATACTTGCTGGCCTATGTTTAG -3'
Posted On2020-07-13