Incidental Mutation 'R8165:Nek9'
ID633738
Institutional Source Beutler Lab
Gene Symbol Nek9
Ensembl Gene ENSMUSG00000034290
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 9
SynonymsC130021H08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8165 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location85299514-85339362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 85303643 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 886 (V886I)
Ref Sequence ENSEMBL: ENSMUSP00000049056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040992] [ENSMUST00000059341]
Predicted Effect probably benign
Transcript: ENSMUST00000040992
AA Change: V886I

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000049056
Gene: ENSMUSG00000034290
AA Change: V886I

DomainStartEndE-ValueType
low complexity region 19 49 N/A INTRINSIC
S_TKc 52 308 1.07e-73 SMART
Pfam:RCC1 389 441 1.2e-9 PFAM
Pfam:RCC1_2 428 457 1.5e-8 PFAM
Pfam:RCC1 444 495 3.6e-13 PFAM
Pfam:RCC1_2 482 511 3.6e-11 PFAM
Pfam:RCC1 499 547 7.6e-14 PFAM
Pfam:RCC1 615 665 4.2e-8 PFAM
Pfam:RCC1_2 652 681 4.4e-7 PFAM
low complexity region 752 767 N/A INTRINSIC
low complexity region 889 900 N/A INTRINSIC
low complexity region 910 927 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000059341
SMART Domains Protein: ENSMUSP00000051664
Gene: ENSMUSG00000045064

DomainStartEndE-ValueType
low complexity region 93 106 N/A INTRINSIC
coiled coil region 207 254 N/A INTRINSIC
Pfam:zf-C2HC_2 378 402 3.6e-10 PFAM
low complexity region 433 444 N/A INTRINSIC
Pfam:zf-C2HC_2 489 513 3.1e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NimA (never in mitosis A) family of serine/threonine protein kinases. The encoded protein is activated in mitosis and, in turn, activates other family members during mitosis. This protein also mediates cellular processes that are essential for interphase progression. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C A 5: 63,897,946 probably null Het
1110037F02Rik T A 4: 11,542,128 D1521E probably benign Het
Amph A G 13: 19,094,837 K161E probably benign Het
Aox2 A T 1: 58,308,929 H602L probably benign Het
Areg A G 5: 91,143,633 N145S probably damaging Het
Arhgap29 C T 3: 121,988,573 T142I probably damaging Het
Bcar3 C T 3: 122,511,156 probably benign Het
Brpf3 C T 17: 28,806,274 A107V probably benign Het
Btnl2 T A 17: 34,368,708 S509T possibly damaging Het
Cacna2d2 A G 9: 107,525,454 probably null Het
Casz1 C T 4: 148,944,431 P1111L probably damaging Het
Ccdc91 C T 6: 147,631,588 T411I unknown Het
Chd9 A C 8: 91,041,141 E2422A probably damaging Het
Clrn3 T C 7: 135,528,404 I34V probably benign Het
Cnksr3 C T 10: 7,154,467 D79N probably damaging Het
Cops8 A G 1: 90,612,007 probably null Het
Cpa2 A G 6: 30,564,346 K392R probably benign Het
Dnajc28 G A 16: 91,616,907 R150* probably null Het
Dnase1l3 T C 14: 7,994,299 probably benign Het
Fam65a C A 8: 105,620,888 L1028M unknown Het
Gdpd5 A T 7: 99,456,482 T502S probably benign Het
Gp2 A T 7: 119,450,152 D387E probably damaging Het
Gpr179 A G 11: 97,351,538 L160P probably benign Het
Hmcn1 G A 1: 150,646,658 T3497M probably benign Het
Idh3b T A 2: 130,280,500 T322S possibly damaging Het
Kit A T 5: 75,620,880 N323I possibly damaging Het
Kng2 T C 16: 22,987,496 S445G unknown Het
Lin54 A G 5: 100,454,499 V393A probably benign Het
Lyst T A 13: 13,698,360 W2715R probably damaging Het
Mad1l1 T C 5: 140,315,058 T28A probably benign Het
Med7 T A 11: 46,441,246 C223S probably benign Het
Megf8 T A 7: 25,353,873 L1823Q probably damaging Het
Mga C A 2: 119,947,238 Q1755K probably benign Het
Mgat4b A T 11: 50,210,974 N22I probably benign Het
Ndufb6 C T 4: 40,270,665 probably null Het
Neil3 A G 8: 53,589,094 L490P probably benign Het
Nol4l A T 2: 153,420,553 Y366* probably null Het
Nt5dc2 A G 14: 31,138,929 T354A probably damaging Het
Olfr339 T A 2: 36,421,703 Y102N probably damaging Het
Pde2a G A 7: 101,500,448 probably null Het
Phf1 T C 17: 26,937,070 F444L possibly damaging Het
Plin4 G A 17: 56,107,019 T202I possibly damaging Het
Plk4 G C 3: 40,813,574 V851L probably damaging Het
Pp2d1 A G 17: 53,515,229 S270P probably damaging Het
Scn9a A G 2: 66,540,530 F569L probably damaging Het
Sel1l2 T A 2: 140,262,706 L306F probably damaging Het
Spic A T 10: 88,677,566 S86T probably damaging Het
Stkld1 A G 2: 26,946,656 N278S probably benign Het
Taar7d T A 10: 24,027,597 F126I probably benign Het
Tbc1d31 A G 15: 57,960,949 E869G possibly damaging Het
Tbcd C T 11: 121,493,885 T315M probably benign Het
Terf2 T C 8: 107,083,024 K221E possibly damaging Het
Tex43 T A 18: 56,589,475 probably benign Het
Thsd7a T A 6: 12,468,963 T539S Het
Tll2 A G 19: 41,088,874 F818L possibly damaging Het
Tmem87a T C 2: 120,370,478 T427A possibly damaging Het
Ush2a C A 1: 188,451,755 Q1419K possibly damaging Het
Vill T A 9: 119,066,753 F511Y probably damaging Het
Vps13c A G 9: 67,858,790 D63G probably benign Het
Vrk2 A G 11: 26,535,575 F138L probably benign Het
Zfp710 T C 7: 80,086,027 I514T probably damaging Het
Zgrf1 T A 3: 127,563,383 F753I possibly damaging Het
Other mutations in Nek9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Nek9 APN 12 85314587 missense probably benign 0.23
IGL01595:Nek9 APN 12 85314420 missense probably damaging 1.00
IGL01603:Nek9 APN 12 85305605 missense probably damaging 1.00
IGL01893:Nek9 APN 12 85336400 missense probably damaging 1.00
IGL02017:Nek9 APN 12 85329923 missense probably damaging 1.00
IGL02197:Nek9 APN 12 85307930 missense probably null
IGL02207:Nek9 APN 12 85303483 nonsense probably null
IGL02749:Nek9 APN 12 85305507 missense probably benign 0.02
IGL02756:Nek9 APN 12 85311336 critical splice donor site probably null
IGL03343:Nek9 APN 12 85303609 missense probably damaging 1.00
Rose_colored UTSW 12 85303537 missense probably damaging 1.00
R0048:Nek9 UTSW 12 85301899 missense probably benign 0.17
R0331:Nek9 UTSW 12 85327375 splice site probably benign
R0499:Nek9 UTSW 12 85301883 missense probably benign 0.09
R1484:Nek9 UTSW 12 85301848 missense probably damaging 1.00
R1760:Nek9 UTSW 12 85305590 missense possibly damaging 0.71
R1760:Nek9 UTSW 12 85310410 missense probably benign 0.00
R1883:Nek9 UTSW 12 85332556 missense probably damaging 1.00
R1884:Nek9 UTSW 12 85332556 missense probably damaging 1.00
R1999:Nek9 UTSW 12 85329903 missense probably damaging 1.00
R2046:Nek9 UTSW 12 85320707 splice site probably benign
R2096:Nek9 UTSW 12 85314548 missense probably benign 0.00
R2150:Nek9 UTSW 12 85329903 missense probably damaging 1.00
R2368:Nek9 UTSW 12 85329887 missense possibly damaging 0.89
R2570:Nek9 UTSW 12 85332546 nonsense probably null
R4381:Nek9 UTSW 12 85329858 missense probably damaging 1.00
R4570:Nek9 UTSW 12 85320734 missense probably damaging 1.00
R4661:Nek9 UTSW 12 85320892 missense possibly damaging 0.78
R4669:Nek9 UTSW 12 85314204 missense probably benign 0.00
R4993:Nek9 UTSW 12 85310420 missense probably damaging 1.00
R5071:Nek9 UTSW 12 85327459 missense possibly damaging 0.70
R5090:Nek9 UTSW 12 85329842 critical splice donor site probably null
R5248:Nek9 UTSW 12 85308977 missense probably damaging 1.00
R5521:Nek9 UTSW 12 85327445 missense probably benign 0.09
R5734:Nek9 UTSW 12 85303515 missense probably benign
R6039:Nek9 UTSW 12 85313085 missense probably benign 0.08
R6039:Nek9 UTSW 12 85313085 missense probably benign 0.08
R6269:Nek9 UTSW 12 85332329 splice site probably null
R6353:Nek9 UTSW 12 85301829 missense probably damaging 0.96
R6406:Nek9 UTSW 12 85339172 missense probably damaging 0.97
R6744:Nek9 UTSW 12 85329929 missense probably benign 0.09
R6922:Nek9 UTSW 12 85303537 missense probably damaging 1.00
R7603:Nek9 UTSW 12 85303514 missense probably benign 0.00
R7686:Nek9 UTSW 12 85303659 missense probably benign 0.01
R7905:Nek9 UTSW 12 85305596 missense probably damaging 1.00
R7964:Nek9 UTSW 12 85339013 missense probably benign 0.02
R8330:Nek9 UTSW 12 85329953 missense probably damaging 1.00
X0052:Nek9 UTSW 12 85322027 critical splice donor site probably null
Z1177:Nek9 UTSW 12 85334045 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGATGTTCTCACCTGCTGG -3'
(R):5'- AAATAGATGATTCTGCAGCAGC -3'

Sequencing Primer
(F):5'- GGCCTCCTTCCAATTTCTTGTTGAG -3'
(R):5'- TTTGTACTGGGGAGCCAT -3'
Posted On2020-07-13