Incidental Mutation 'R8165:Lyst'
ID 633739
Institutional Source Beutler Lab
Gene Symbol Lyst
Ensembl Gene ENSMUSG00000019726
Gene Name lysosomal trafficking regulator
Synonyms D13Sfk13
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_010748.2; MGI:107448
Essential gene? Possibly non essential (E-score: 0.300) question?
Stock # R8165 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 13590397-13778803 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 13698360 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 2715 (W2715R)
Ref Sequence ENSEMBL: ENSMUSP00000106188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110559]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000110559
AA Change: W2715R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106188
Gene: ENSMUSG00000019726
AA Change: W2715R

DomainStartEndE-ValueType
low complexity region 26 36 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
low complexity region 399 412 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 2295 2307 N/A INTRINSIC
low complexity region 2427 2445 N/A INTRINSIC
low complexity region 2534 2546 N/A INTRINSIC
Pfam:PH_BEACH 3006 3101 5.8e-25 PFAM
Beach 3118 3408 1.25e-193 SMART
Blast:Beach 3441 3478 9e-13 BLAST
WD40 3539 3579 5.75e-1 SMART
WD40 3591 3630 2.89e-5 SMART
WD40 3633 3676 1.38e0 SMART
WD40 3724 3765 1.27e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (65/65)
MGI Phenotype Strain: 1855968
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that regulates intracellular protein trafficking in endosomes, and may be involved in pigmentation. Mutations in this gene are associated with Chediak-Higashi syndrome, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants, though the full-length nature of some of these variants has not been determined. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous mice have a phenotype similar to human Chediak-Higashi syndrome patients, exhibiting lysosomal dysfunction with resultant protein storage; diluted coat color; abnormal melanogenesis; immune cell dysfunction resulting in increased susceptibility to bacterial, viral, and parasitic infections and decreased cytotoxic activity against tumor cells. [provided by MGI curators]
Allele List at MGI

All alleles(52) : Targeted(3) Gene trapped(34) Spontaneous(8) Chemically induced(6) Radiation induced(1)
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C A 5: 63,897,946 probably null Het
Amph A G 13: 19,094,837 K161E probably benign Het
Aox2 A T 1: 58,308,929 H602L probably benign Het
Areg A G 5: 91,143,633 N145S probably damaging Het
Arhgap29 C T 3: 121,988,573 T142I probably damaging Het
Bcar3 C T 3: 122,511,156 probably benign Het
Brpf3 C T 17: 28,806,274 A107V probably benign Het
Btnl2 T A 17: 34,368,708 S509T possibly damaging Het
Cacna2d2 A G 9: 107,525,454 probably null Het
Casz1 C T 4: 148,944,431 P1111L probably damaging Het
Ccdc91 C T 6: 147,631,588 T411I unknown Het
Chd9 A C 8: 91,041,141 E2422A probably damaging Het
Clrn3 T C 7: 135,528,404 I34V probably benign Het
Cnksr3 C T 10: 7,154,467 D79N probably damaging Het
Cops8 A G 1: 90,612,007 probably null Het
Cpa2 A G 6: 30,564,346 K392R probably benign Het
Dnajc28 G A 16: 91,616,907 R150* probably null Het
Dnase1l3 T C 14: 7,994,299 probably benign Het
Gdpd5 A T 7: 99,456,482 T502S probably benign Het
Gp2 A T 7: 119,450,152 D387E probably damaging Het
Gpr179 A G 11: 97,351,538 L160P probably benign Het
Hmcn1 G A 1: 150,646,658 T3497M probably benign Het
Idh3b T A 2: 130,280,500 T322S possibly damaging Het
Kit A T 5: 75,620,880 N323I possibly damaging Het
Kng2 T C 16: 22,987,496 S445G unknown Het
Lin54 A G 5: 100,454,499 V393A probably benign Het
Mad1l1 T C 5: 140,315,058 T28A probably benign Het
Med7 T A 11: 46,441,246 C223S probably benign Het
Megf8 T A 7: 25,353,873 L1823Q probably damaging Het
Mga C A 2: 119,947,238 Q1755K probably benign Het
Mgat4b A T 11: 50,210,974 N22I probably benign Het
Ndufb6 C T 4: 40,270,665 probably null Het
Neil3 A G 8: 53,589,094 L490P probably benign Het
Nek9 C T 12: 85,303,643 V886I probably benign Het
Nol4l A T 2: 153,420,553 Y366* probably null Het
Nt5dc2 A G 14: 31,138,929 T354A probably damaging Het
Olfr339 T A 2: 36,421,703 Y102N probably damaging Het
Pde2a G A 7: 101,500,448 probably null Het
Phf1 T C 17: 26,937,070 F444L possibly damaging Het
Plin4 G A 17: 56,107,019 T202I possibly damaging Het
Plk4 G C 3: 40,813,574 V851L probably damaging Het
Pp2d1 A G 17: 53,515,229 S270P probably damaging Het
Ripor1 C A 8: 105,620,888 L1028M unknown Het
Scn9a A G 2: 66,540,530 F569L probably damaging Het
Sel1l2 T A 2: 140,262,706 L306F probably damaging Het
Spic A T 10: 88,677,566 S86T probably damaging Het
Stkld1 A G 2: 26,946,656 N278S probably benign Het
Taar7d T A 10: 24,027,597 F126I probably benign Het
Tbc1d31 A G 15: 57,960,949 E869G possibly damaging Het
Tbcd C T 11: 121,493,885 T315M probably benign Het
Terf2 T C 8: 107,083,024 K221E possibly damaging Het
Tex43 T A 18: 56,589,475 probably benign Het
Thsd7a T A 6: 12,468,963 T539S Het
Tll2 A G 19: 41,088,874 F818L possibly damaging Het
Tmem87a T C 2: 120,370,478 T427A possibly damaging Het
Ush2a C A 1: 188,451,755 Q1419K possibly damaging Het
Vill T A 9: 119,066,753 F511Y probably damaging Het
Virma T A 4: 11,542,128 D1521E probably benign Het
Vps13c A G 9: 67,858,790 D63G probably benign Het
Vrk2 A G 11: 26,535,575 F138L probably benign Het
Zfp710 T C 7: 80,086,027 I514T probably damaging Het
Zgrf1 T A 3: 127,563,383 F753I possibly damaging Het
Other mutations in Lyst
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Lyst APN 13 13648878 missense probably benign
IGL00474:Lyst APN 13 13643536 missense possibly damaging 0.48
IGL00484:Lyst APN 13 13709603 missense probably benign 0.02
IGL00492:Lyst APN 13 13678175 missense possibly damaging 0.54
IGL00807:Lyst APN 13 13650423 missense possibly damaging 0.91
IGL00949:Lyst APN 13 13635485 missense possibly damaging 0.87
IGL00952:Lyst APN 13 13678107 missense probably benign 0.05
IGL01305:Lyst APN 13 13678056 missense probably benign 0.01
IGL01317:Lyst APN 13 13670870 missense probably benign
IGL01419:Lyst APN 13 13635838 missense probably benign 0.00
IGL01445:Lyst APN 13 13651714 missense probably benign 0.00
IGL01690:Lyst APN 13 13743246 missense probably damaging 1.00
IGL01791:Lyst APN 13 13635302 missense probably damaging 1.00
IGL01809:Lyst APN 13 13637803 missense probably damaging 1.00
IGL01896:Lyst APN 13 13635577 missense probably benign 0.04
IGL01938:Lyst APN 13 13637424 missense possibly damaging 0.93
IGL01986:Lyst APN 13 13775627 critical splice donor site probably null
IGL02022:Lyst APN 13 13664044 nonsense probably null
IGL02044:Lyst APN 13 13712846 missense probably damaging 1.00
IGL02157:Lyst APN 13 13660956 missense probably benign
IGL02185:Lyst APN 13 13661093 nonsense probably null
IGL02215:Lyst APN 13 13660956 missense probably benign
IGL02245:Lyst APN 13 13660956 missense probably benign
IGL02246:Lyst APN 13 13660956 missense probably benign
IGL02247:Lyst APN 13 13660956 missense probably benign
IGL02297:Lyst APN 13 13638092 nonsense probably null
IGL02411:Lyst APN 13 13660956 missense probably benign
IGL02415:Lyst APN 13 13660956 missense probably benign
IGL02419:Lyst APN 13 13660956 missense probably benign
IGL02420:Lyst APN 13 13660956 missense probably benign
IGL02429:Lyst APN 13 13660956 missense probably benign
IGL02501:Lyst APN 13 13711645 missense probably benign 0.02
IGL02522:Lyst APN 13 13634705 missense possibly damaging 0.81
IGL02535:Lyst APN 13 13650342 missense probably benign 0.00
IGL02596:Lyst APN 13 13660956 missense probably benign
IGL02601:Lyst APN 13 13660956 missense probably benign
IGL02603:Lyst APN 13 13660956 missense probably benign
IGL02608:Lyst APN 13 13712754 missense probably damaging 0.98
IGL02622:Lyst APN 13 13681390 missense probably damaging 1.00
IGL02690:Lyst APN 13 13641125 missense possibly damaging 0.58
IGL02715:Lyst APN 13 13674320 splice site probably null
IGL02725:Lyst APN 13 13760827 missense probably damaging 1.00
IGL02729:Lyst APN 13 13674339 missense possibly damaging 0.81
IGL02729:Lyst APN 13 13746609 missense possibly damaging 0.95
IGL02820:Lyst APN 13 13638058 missense probably benign 0.03
IGL02945:Lyst APN 13 13761198 missense possibly damaging 0.48
IGL02981:Lyst APN 13 13634911 missense probably damaging 0.99
IGL03087:Lyst APN 13 13635056 missense probably damaging 1.00
IGL03149:Lyst APN 13 13681444 missense probably benign 0.14
IGL03158:Lyst APN 13 13651752 critical splice donor site probably null
IGL03226:Lyst APN 13 13709559 missense probably benign 0.01
IGL03242:Lyst APN 13 13656881 nonsense probably null
IGL03385:Lyst APN 13 13656980 nonsense probably null
50-cal UTSW 13 13708212 critical splice donor site probably null
charcoal UTSW 13 13696761 nonsense probably null
charlotte_gray UTSW 13 13602026 intron probably benign
charzard UTSW 13 13647083 nonsense probably null
grey_wolf UTSW 13 unclassified
lightspeed UTSW 13 13740536 missense possibly damaging 0.91
pardon UTSW 13 13677952 missense probably benign 0.00
robin UTSW 13 13648802 nonsense probably null
sooty UTSW 13 unclassified
souris UTSW 13 13683223 unclassified probably benign
Swallow UTSW 13 13757422 missense probably benign 0.00
vulpix UTSW 13 13696794 splice site probably null
ANU22:Lyst UTSW 13 13678056 missense probably benign 0.01
IGL02835:Lyst UTSW 13 13661100 missense possibly damaging 0.82
P0031:Lyst UTSW 13 13664031 missense probably damaging 1.00
R0012:Lyst UTSW 13 13687694 missense probably benign 0.10
R0012:Lyst UTSW 13 13687694 missense probably benign 0.10
R0031:Lyst UTSW 13 13708156 missense probably benign 0.14
R0115:Lyst UTSW 13 13677952 missense probably benign 0.00
R0212:Lyst UTSW 13 13635985 missense possibly damaging 0.93
R0386:Lyst UTSW 13 13708214 splice site probably benign
R0393:Lyst UTSW 13 13647079 missense probably benign 0.01
R0415:Lyst UTSW 13 13711610 splice site probably benign
R0446:Lyst UTSW 13 13638048 missense probably benign 0.00
R0481:Lyst UTSW 13 13677952 missense probably benign 0.00
R0499:Lyst UTSW 13 13616713 missense probably damaging 1.00
R0506:Lyst UTSW 13 13638015 missense probably benign
R0530:Lyst UTSW 13 13757306 splice site probably benign
R0541:Lyst UTSW 13 13681293 missense probably benign 0.00
R0570:Lyst UTSW 13 13709386 missense probably benign 0.26
R0680:Lyst UTSW 13 13650341 missense probably benign 0.01
R0842:Lyst UTSW 13 13678241 nonsense probably null
R0848:Lyst UTSW 13 13634930 missense probably benign 0.00
R1014:Lyst UTSW 13 13634060 missense possibly damaging 0.49
R1205:Lyst UTSW 13 13680202 missense probably benign
R1251:Lyst UTSW 13 13634483 missense probably benign 0.00
R1304:Lyst UTSW 13 13751984 nonsense probably null
R1398:Lyst UTSW 13 13740536 missense possibly damaging 0.91
R1445:Lyst UTSW 13 13640054 missense possibly damaging 0.94
R1475:Lyst UTSW 13 13708212 critical splice donor site probably null
R1479:Lyst UTSW 13 13634482 missense probably benign 0.00
R1484:Lyst UTSW 13 13678190 missense probably benign 0.01
R1498:Lyst UTSW 13 13650375 missense possibly damaging 0.49
R1540:Lyst UTSW 13 13635101 missense possibly damaging 0.81
R1611:Lyst UTSW 13 13634897 missense probably damaging 0.97
R1653:Lyst UTSW 13 13635226 missense probably damaging 1.00
R1669:Lyst UTSW 13 13644087 missense possibly damaging 0.90
R1686:Lyst UTSW 13 13634705 missense possibly damaging 0.81
R1694:Lyst UTSW 13 13661161 missense probably damaging 0.98
R1747:Lyst UTSW 13 13757422 missense probably benign 0.00
R1793:Lyst UTSW 13 13647083 nonsense probably null
R1871:Lyst UTSW 13 13651712 missense probably benign 0.00
R1905:Lyst UTSW 13 13634134 missense probably benign
R1958:Lyst UTSW 13 13616618 missense probably damaging 1.00
R1969:Lyst UTSW 13 13730344 missense probably damaging 0.99
R2040:Lyst UTSW 13 13641222 missense probably benign 0.00
R2109:Lyst UTSW 13 13712820 missense possibly damaging 0.46
R2116:Lyst UTSW 13 13635701 missense probably damaging 0.99
R2121:Lyst UTSW 13 13660971 missense probably damaging 1.00
R2127:Lyst UTSW 13 13635262 missense probably damaging 1.00
R2187:Lyst UTSW 13 13709341 missense possibly damaging 0.61
R2238:Lyst UTSW 13 13743263 missense probably benign 0.41
R2258:Lyst UTSW 13 13637658 missense probably benign 0.00
R2292:Lyst UTSW 13 13740495 missense probably damaging 1.00
R2368:Lyst UTSW 13 13696663 missense probably damaging 0.96
R2908:Lyst UTSW 13 13669873 missense probably benign 0.03
R3001:Lyst UTSW 13 13696705 missense probably benign
R3002:Lyst UTSW 13 13696705 missense probably benign
R3024:Lyst UTSW 13 13658687 missense probably benign
R3113:Lyst UTSW 13 13669927 missense probably benign 0.12
R3406:Lyst UTSW 13 13635230 missense possibly damaging 0.56
R3972:Lyst UTSW 13 13706625 missense possibly damaging 0.67
R3978:Lyst UTSW 13 13634168 missense possibly damaging 0.82
R4032:Lyst UTSW 13 13616665 missense probably damaging 1.00
R4192:Lyst UTSW 13 13740513 missense probably damaging 1.00
R4206:Lyst UTSW 13 13635989 missense probably benign 0.03
R4298:Lyst UTSW 13 13634887 missense probably damaging 1.00
R4344:Lyst UTSW 13 13698466 missense probably benign 0.06
R4441:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4445:Lyst UTSW 13 13709564 missense probably benign 0.42
R4477:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4493:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4494:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4495:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4622:Lyst UTSW 13 13674398 missense probably benign 0.01
R4638:Lyst UTSW 13 13696794 splice site probably null
R4658:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4675:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4719:Lyst UTSW 13 13650350 missense probably benign
R4729:Lyst UTSW 13 13637901 missense probably damaging 1.00
R4774:Lyst UTSW 13 13740597 missense probably damaging 1.00
R4811:Lyst UTSW 13 13777100 missense probably benign 0.33
R4877:Lyst UTSW 13 13683149 missense probably damaging 1.00
R4920:Lyst UTSW 13 13647060 missense possibly damaging 0.79
R4933:Lyst UTSW 13 13637764 missense probably damaging 0.98
R4933:Lyst UTSW 13 13759378 missense probably benign 0.12
R4958:Lyst UTSW 13 13635463 missense probably benign 0.00
R4982:Lyst UTSW 13 13725954 missense probably damaging 1.00
R4992:Lyst UTSW 13 13661163 missense probably damaging 1.00
R5024:Lyst UTSW 13 13634404 missense probably benign
R5049:Lyst UTSW 13 13636064 missense probably damaging 1.00
R5079:Lyst UTSW 13 13757353 missense probably benign 0.08
R5254:Lyst UTSW 13 13683070 missense probably benign 0.00
R5266:Lyst UTSW 13 13660970 missense probably damaging 1.00
R5279:Lyst UTSW 13 13648802 nonsense probably null
R5285:Lyst UTSW 13 13634426 missense probably benign 0.01
R5364:Lyst UTSW 13 13656854 missense probably benign 0.35
R5435:Lyst UTSW 13 13777064 missense possibly damaging 0.64
R5516:Lyst UTSW 13 13644122 missense probably benign 0.10
R5524:Lyst UTSW 13 13746779 missense probably benign 0.03
R5591:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5592:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5593:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5594:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5594:Lyst UTSW 13 13759397 missense probably benign 0.00
R5644:Lyst UTSW 13 13637496 missense possibly damaging 0.58
R5659:Lyst UTSW 13 13634627 missense possibly damaging 0.58
R5741:Lyst UTSW 13 13634030 missense probably benign 0.44
R5908:Lyst UTSW 13 13696761 nonsense probably null
R5969:Lyst UTSW 13 13687813 splice site probably null
R6128:Lyst UTSW 13 13759379 missense possibly damaging 0.67
R6271:Lyst UTSW 13 13658754 missense probably benign 0.30
R6315:Lyst UTSW 13 13643504 missense probably benign
R6318:Lyst UTSW 13 13743311 missense possibly damaging 0.88
R6555:Lyst UTSW 13 13648925 missense probably benign 0.01
R6663:Lyst UTSW 13 13664116 splice site probably null
R6701:Lyst UTSW 13 13681485 missense probably benign 0.06
R6711:Lyst UTSW 13 13635235 missense possibly damaging 0.80
R6909:Lyst UTSW 13 13743375 missense probably damaging 1.00
R6915:Lyst UTSW 13 13726044 missense probably benign 0.01
R6929:Lyst UTSW 13 13743324 missense probably damaging 1.00
R6960:Lyst UTSW 13 13634078 missense probably benign 0.12
R7018:Lyst UTSW 13 13743459 critical splice donor site probably null
R7037:Lyst UTSW 13 13616666 missense probably damaging 1.00
R7045:Lyst UTSW 13 13634900 missense probably benign 0.34
R7045:Lyst UTSW 13 13637708 missense probably damaging 1.00
R7070:Lyst UTSW 13 13757444 missense probably benign 0.23
R7188:Lyst UTSW 13 13752090 missense possibly damaging 0.66
R7201:Lyst UTSW 13 13709300 nonsense probably null
R7210:Lyst UTSW 13 13656983 missense probably damaging 1.00
R7229:Lyst UTSW 13 13643509 missense probably benign 0.00
R7293:Lyst UTSW 13 13680237 missense probably benign 0.01
R7318:Lyst UTSW 13 13757443 missense probably benign 0.13
R7344:Lyst UTSW 13 13706555 missense probably benign
R7426:Lyst UTSW 13 13637524 missense probably benign
R7522:Lyst UTSW 13 13647083 nonsense probably null
R7583:Lyst UTSW 13 13635887 missense probably damaging 1.00
R7606:Lyst UTSW 13 13637475 missense probably damaging 1.00
R7636:Lyst UTSW 13 13616747 critical splice donor site probably null
R7658:Lyst UTSW 13 13730476 missense possibly damaging 0.63
R7685:Lyst UTSW 13 13669865 missense probably benign 0.00
R7689:Lyst UTSW 13 13683223 critical splice donor site probably null
R7765:Lyst UTSW 13 13709532 missense possibly damaging 0.75
R7779:Lyst UTSW 13 13634543 missense probably damaging 1.00
R7871:Lyst UTSW 13 13636052 nonsense probably null
R7872:Lyst UTSW 13 13635865 missense probably benign 0.14
R7884:Lyst UTSW 13 13707683 missense probably benign 0.09
R7890:Lyst UTSW 13 13740569 missense probably damaging 0.99
R7916:Lyst UTSW 13 13647072 missense possibly damaging 0.64
R7948:Lyst UTSW 13 13746589 missense possibly damaging 0.59
R7956:Lyst UTSW 13 13641203 missense possibly damaging 0.80
R8048:Lyst UTSW 13 13687645 missense probably benign 0.12
R8085:Lyst UTSW 13 13634309 missense probably damaging 0.98
R8235:Lyst UTSW 13 13760738 missense possibly damaging 0.69
R8237:Lyst UTSW 13 13651732 missense probably benign 0.00
R8275:Lyst UTSW 13 13776082 missense probably benign 0.02
R8300:Lyst UTSW 13 13664058 missense possibly damaging 0.79
R8350:Lyst UTSW 13 13650388 nonsense probably null
R8526:Lyst UTSW 13 13760806 missense probably damaging 0.99
R8551:Lyst UTSW 13 13634060 missense possibly damaging 0.77
R8723:Lyst UTSW 13 13712757 missense possibly damaging 0.89
R8772:Lyst UTSW 13 13637492 nonsense probably null
R8778:Lyst UTSW 13 13635776 missense possibly damaging 0.89
R8778:Lyst UTSW 13 13728567 missense possibly damaging 0.89
R8801:Lyst UTSW 13 13661010 missense probably benign 0.10
R8837:Lyst UTSW 13 13677963 missense probably benign
R8874:Lyst UTSW 13 13637562 missense probably benign
R8878:Lyst UTSW 13 13641076 missense probably benign 0.00
R8891:Lyst UTSW 13 13712850 missense possibly damaging 0.67
R9077:Lyst UTSW 13 13683108 missense probably benign 0.02
R9127:Lyst UTSW 13 13634242 missense probably damaging 1.00
R9143:Lyst UTSW 13 13661165 missense probably damaging 0.98
R9216:Lyst UTSW 13 13648603 missense probably benign
R9217:Lyst UTSW 13 13696660 missense probably benign 0.01
R9291:Lyst UTSW 13 13709353 missense probably benign 0.01
R9302:Lyst UTSW 13 13730362 missense possibly damaging 0.46
R9370:Lyst UTSW 13 13760748 missense probably damaging 1.00
R9402:Lyst UTSW 13 13637878 missense probably benign
R9457:Lyst UTSW 13 13687745 missense possibly damaging 0.83
R9481:Lyst UTSW 13 13683068 missense possibly damaging 0.68
R9563:Lyst UTSW 13 13637823 missense probably benign 0.36
R9623:Lyst UTSW 13 13678002 missense probably benign
R9661:Lyst UTSW 13 13634194 missense probably benign 0.01
R9682:Lyst UTSW 13 13656941 missense probably benign 0.21
R9743:Lyst UTSW 13 13634738 missense possibly damaging 0.67
R9801:Lyst UTSW 13 13634705 missense probably damaging 0.97
RF001:Lyst UTSW 13 13635841 missense probably benign
RF002:Lyst UTSW 13 13634363 missense probably benign 0.05
X0024:Lyst UTSW 13 13634448 missense probably benign 0.00
X0026:Lyst UTSW 13 13751970 missense probably damaging 0.99
Z1088:Lyst UTSW 13 13743433 missense probably benign 0.09
Z1176:Lyst UTSW 13 13640107 missense probably damaging 1.00
Z1176:Lyst UTSW 13 13777079 missense probably benign 0.27
Z1177:Lyst UTSW 13 13680134 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CCTTGAGTTTCTGTGAGGCTAA -3'
(R):5'- AGGGCTTTATCAAATGCTGAGA -3'

Sequencing Primer
(F):5'- AAGAAGTCTGATCCTGAGCTGTCC -3'
(R):5'- CAAATGCTGAGATACTTACTTGTGGG -3'
Posted On 2020-07-13