Incidental Mutation 'R0692:Vmn1r23'
ID63374
Institutional Source Beutler Lab
Gene Symbol Vmn1r23
Ensembl Gene ENSMUSG00000093376
Gene Namevomeronasal 1 receptor 23
SynonymsV1rc24
MMRRC Submission 038877-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R0692 (G1)
Quality Score88
Status Not validated
Chromosome6
Chromosomal Location57925842-57926838 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 57926125 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 223 (E223*)
Ref Sequence ENSEMBL: ENSMUSP00000135676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000175817]
Predicted Effect probably null
Transcript: ENSMUST00000175817
AA Change: E223*
SMART Domains Protein: ENSMUSP00000135676
Gene: ENSMUSG00000093376
AA Change: E223*

DomainStartEndE-ValueType
Pfam:V1R 28 293 3.1e-57 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add3 T A 19: 53,216,952 D44E probably damaging Het
Bpifb5 T C 2: 154,234,696 V421A probably benign Het
Clk4 C T 11: 51,281,328 R273* probably null Het
Cmya5 A T 13: 93,093,849 L1577* probably null Het
Col14a1 G C 15: 55,341,738 G88A unknown Het
Helz2 A G 2: 181,240,881 C40R probably benign Het
Kcng1 T A 2: 168,262,763 I388F probably damaging Het
Krt35 T C 11: 100,093,070 E368G possibly damaging Het
Krt81 T C 15: 101,460,172 D400G possibly damaging Het
Mcm3ap T C 10: 76,483,169 C744R probably damaging Het
Olfr1033 A G 2: 86,042,172 M286V probably benign Het
Pde6c A T 19: 38,180,250 Y788F probably damaging Het
Plxnc1 A G 10: 94,837,500 probably null Het
Rflnb T C 11: 76,027,453 D62G probably benign Het
Sema4f CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 6: 82,939,530 probably benign Het
Slc12a1 T A 2: 125,194,162 Y651* probably null Het
Srbd1 T C 17: 86,136,460 T113A probably benign Het
Svopl A T 6: 38,017,196 L300Q probably damaging Het
Trim41 C T 11: 48,808,250 probably null Het
Other mutations in Vmn1r23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01563:Vmn1r23 APN 6 57926076 missense possibly damaging 0.89
IGL01980:Vmn1r23 APN 6 57926490 missense probably damaging 1.00
IGL02934:Vmn1r23 APN 6 57925929 missense probably benign 0.26
IGL03153:Vmn1r23 APN 6 57925932 missense probably damaging 0.98
R0410:Vmn1r23 UTSW 6 57926190 missense probably benign 0.11
R0452:Vmn1r23 UTSW 6 57926484 missense possibly damaging 0.90
R0590:Vmn1r23 UTSW 6 57926364 missense probably benign 0.43
R0647:Vmn1r23 UTSW 6 57926184 missense probably benign
R1674:Vmn1r23 UTSW 6 57926061 missense possibly damaging 0.75
R1744:Vmn1r23 UTSW 6 57925925 missense possibly damaging 0.81
R1774:Vmn1r23 UTSW 6 57926690 missense probably damaging 0.97
R2101:Vmn1r23 UTSW 6 57926452 missense possibly damaging 0.90
R2202:Vmn1r23 UTSW 6 57926619 missense probably benign 0.01
R2204:Vmn1r23 UTSW 6 57926619 missense probably benign 0.01
R2205:Vmn1r23 UTSW 6 57926619 missense probably benign 0.01
R4282:Vmn1r23 UTSW 6 57926467 missense probably benign 0.27
R4408:Vmn1r23 UTSW 6 57926368 missense probably benign 0.01
R4532:Vmn1r23 UTSW 6 57925929 missense probably benign 0.21
R4690:Vmn1r23 UTSW 6 57926025 missense probably benign
R4700:Vmn1r23 UTSW 6 57926205 missense probably benign 0.17
R4894:Vmn1r23 UTSW 6 57926325 missense probably benign 0.00
R6164:Vmn1r23 UTSW 6 57926055 missense possibly damaging 0.90
R6930:Vmn1r23 UTSW 6 57926145 missense probably benign
R7129:Vmn1r23 UTSW 6 57926076 missense possibly damaging 0.89
R7731:Vmn1r23 UTSW 6 57926334 missense probably benign 0.03
R7877:Vmn1r23 UTSW 6 57926556 missense probably benign
R8751:Vmn1r23 UTSW 6 57926467 missense probably benign 0.27
R8809:Vmn1r23 UTSW 6 57926367 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGTGGGATAGGCATTCACCACAAAC -3'
(R):5'- GTGTGTTCCAGGCTGTCACTATCAG -3'

Sequencing Primer
(F):5'- CAAACTTCTGAACAGTCAGGATG -3'
(R):5'- GGCTGTCACTATCAGTCCCAG -3'
Posted On2013-07-30