Mutagenetix > Incidental Mutations

Incidental Mutation 'R8165:Amph'

633740

Institutional Source

Beutler Lab

Gene Symbol

Amph

Ensembl Gene

ENSMUSG00000021314

Gene Name

amphiphysin

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.294) question?

Stock #

R8165 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

18948205-19150921 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 19094837 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 161 (K161E)

Ref Sequence

ENSEMBL: ENSMUSP00000142766 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003345] [ENSMUST00000200466]

Predicted Effect

SMART Domains

Protein: ENSMUSP00000003345
Gene: ENSMUSG00000021314
AA Change: K161E

Domain	Start	End	E-Value	Type
BAR	12	233	8.47e-80	SMART
low complexity region	260	277	N/A	INTRINSIC
low complexity region	282	295	N/A	INTRINSIC
low complexity region	301	315	N/A	INTRINSIC
low complexity region	341	362	N/A	INTRINSIC
low complexity region	424	445	N/A	INTRINSIC
low complexity region	479	499	N/A	INTRINSIC
SH3	616	686	7.82e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000200466
AA Change: K161E

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000142766
Gene: ENSMUSG00000021314
AA Change: K161E

Domain	Start	End	E-Value	Type
BAR	12	233	2.3e-82	SMART
low complexity region	260	277	N/A	INTRINSIC
low complexity region	282	295	N/A	INTRINSIC
low complexity region	301	315	N/A	INTRINSIC
low complexity region	341	362	N/A	INTRINSIC
low complexity region	428	449	N/A	INTRINSIC
low complexity region	483	503	N/A	INTRINSIC
SH3	620	690	4.9e-12	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the cytoplasmic surface of synaptic vesicles. A subset of patients with stiff-man syndrome who were also affected by breast cancer are positive for autoantibodies against this protein. Alternate splicing of this gene results in two transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences have not been determined. A pseudogene of this gene is found on chromosome 11.[provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a targeted mutation of this gene exhibit learning deficits and synaptic vesicle recycling defects, and die between 2 to 5 months of age from rare irreversible seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	C	A	5: 63,897,946		probably null	Het
1110037F02Rik	T	A	4: 11,542,128	D1521E	probably benign	Het
Aox2	A	T	1: 58,308,929	H602L	probably benign	Het
Areg	A	G	5: 91,143,633	N145S	probably damaging	Het
Arhgap29	C	T	3: 121,988,573	T142I	probably damaging	Het
Bcar3	C	T	3: 122,511,156		probably benign	Het
Brpf3	C	T	17: 28,806,274	A107V	probably benign	Het
Btnl2	T	A	17: 34,368,708	S509T	possibly damaging	Het
Cacna2d2	A	G	9: 107,525,454		probably null	Het
Casz1	C	T	4: 148,944,431	P1111L	probably damaging	Het
Ccdc91	C	T	6: 147,631,588	T411I	unknown	Het
Chd9	A	C	8: 91,041,141	E2422A	probably damaging	Het
Clrn3	T	C	7: 135,528,404	I34V	probably benign	Het
Cnksr3	C	T	10: 7,154,467	D79N	probably damaging	Het
Cops8	A	G	1: 90,612,007		probably null	Het
Cpa2	A	G	6: 30,564,346	K392R	probably benign	Het
Dnajc28	G	A	16: 91,616,907	R150*	probably null	Het
Dnase1l3	T	C	14: 7,994,299		probably benign	Het
Fam65a	C	A	8: 105,620,888	L1028M	unknown	Het
Gdpd5	A	T	7: 99,456,482	T502S	probably benign	Het
Gp2	A	T	7: 119,450,152	D387E	probably damaging	Het
Gpr179	A	G	11: 97,351,538	L160P	probably benign	Het
Hmcn1	G	A	1: 150,646,658	T3497M	probably benign	Het
Idh3b	T	A	2: 130,280,500	T322S	possibly damaging	Het
Kit	A	T	5: 75,620,880	N323I	possibly damaging	Het
Kng2	T	C	16: 22,987,496	S445G	unknown	Het
Lin54	A	G	5: 100,454,499	V393A	probably benign	Het
Lyst	T	A	13: 13,698,360	W2715R	probably damaging	Het
Mad1l1	T	C	5: 140,315,058	T28A	probably benign	Het
Med7	T	A	11: 46,441,246	C223S	probably benign	Het
Megf8	T	A	7: 25,353,873	L1823Q	probably damaging	Het
Mga	C	A	2: 119,947,238	Q1755K	probably benign	Het
Mgat4b	A	T	11: 50,210,974	N22I	probably benign	Het
Ndufb6	C	T	4: 40,270,665		probably null	Het
Neil3	A	G	8: 53,589,094	L490P	probably benign	Het
Nek9	C	T	12: 85,303,643	V886I	probably benign	Het
Nol4l	A	T	2: 153,420,553	Y366*	probably null	Het
Nt5dc2	A	G	14: 31,138,929	T354A	probably damaging	Het
Olfr339	T	A	2: 36,421,703	Y102N	probably damaging	Het
Pde2a	G	A	7: 101,500,448		probably null	Het
Phf1	T	C	17: 26,937,070	F444L	possibly damaging	Het
Plin4	G	A	17: 56,107,019	T202I	possibly damaging	Het
Plk4	G	C	3: 40,813,574	V851L	probably damaging	Het
Pp2d1	A	G	17: 53,515,229	S270P	probably damaging	Het
Scn9a	A	G	2: 66,540,530	F569L	probably damaging	Het
Sel1l2	T	A	2: 140,262,706	L306F	probably damaging	Het
Spic	A	T	10: 88,677,566	S86T	probably damaging	Het
Stkld1	A	G	2: 26,946,656	N278S	probably benign	Het
Taar7d	T	A	10: 24,027,597	F126I	probably benign	Het
Tbc1d31	A	G	15: 57,960,949	E869G	possibly damaging	Het
Tbcd	C	T	11: 121,493,885	T315M	probably benign	Het
Terf2	T	C	8: 107,083,024	K221E	possibly damaging	Het
Tex43	T	A	18: 56,589,475		probably benign	Het
Thsd7a	T	A	6: 12,468,963	T539S		Het
Tll2	A	G	19: 41,088,874	F818L	possibly damaging	Het
Tmem87a	T	C	2: 120,370,478	T427A	possibly damaging	Het
Ush2a	C	A	1: 188,451,755	Q1419K	possibly damaging	Het
Vill	T	A	9: 119,066,753	F511Y	probably damaging	Het
Vps13c	A	G	9: 67,858,790	D63G	probably benign	Het
Vrk2	A	G	11: 26,535,575	F138L	probably benign	Het
Zfp710	T	C	7: 80,086,027	I514T	probably damaging	Het
Zgrf1	T	A	3: 127,563,383	F753I	possibly damaging	Het

Other mutations in Amph

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:Amph	APN	13	19120606	missense	probably damaging	1.00
IGL01866:Amph	APN	13	19142002	missense	probably damaging	1.00
IGL02157:Amph	APN	13	19104231	missense	possibly damaging	0.60
IGL02300:Amph	APN	13	19086604	missense	probably damaging	1.00
IGL02435:Amph	APN	13	19139163	splice site	probably benign
IGL03060:Amph	APN	13	19094814	missense	probably damaging	0.99
IGL03122:Amph	APN	13	19102943	missense	probably damaging	0.98
R0037:Amph	UTSW	13	19100653	missense	possibly damaging	0.90
R0646:Amph	UTSW	13	19113116	missense	possibly damaging	0.95
R0652:Amph	UTSW	13	19086621	splice site	probably null
R1005:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1006:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1199:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1200:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1201:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1333:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1334:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1335:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1337:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1338:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1384:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1397:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1501:Amph	UTSW	13	19104291	nonsense	probably null
R1528:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1822:Amph	UTSW	13	18948455	missense	probably damaging	0.98
R2004:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R2006:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R2061:Amph	UTSW	13	19125035	nonsense	probably null
R2111:Amph	UTSW	13	19116266	splice site	probably benign
R2329:Amph	UTSW	13	19139350	missense	probably benign
R2878:Amph	UTSW	13	19104267	missense	possibly damaging	0.95
R3121:Amph	UTSW	13	19113146	nonsense	probably null
R3548:Amph	UTSW	13	19102959	missense	probably damaging	1.00
R4059:Amph	UTSW	13	19141998	missense	probably damaging	1.00
R4369:Amph	UTSW	13	19137700	missense	probably benign	0.20
R4492:Amph	UTSW	13	19149758	missense	possibly damaging	0.76
R4855:Amph	UTSW	13	19084208	missense	probably damaging	1.00
R4937:Amph	UTSW	13	19104345	missense	probably damaging	1.00
R4965:Amph	UTSW	13	19137699	missense	probably benign	0.12
R5777:Amph	UTSW	13	19046016	missense	probably damaging	1.00
R5787:Amph	UTSW	13	18948454	missense	possibly damaging	0.75
R6091:Amph	UTSW	13	19125123	missense	probably benign	0.01
R7100:Amph	UTSW	13	19149841	makesense	probably null
R7103:Amph	UTSW	13	19149738	missense	probably benign	0.00
R7451:Amph	UTSW	13	19077368	missense	probably damaging	1.00
R7522:Amph	UTSW	13	19086545	missense	probably damaging	0.96
R8166:Amph	UTSW	13	18948490	missense	possibly damaging	0.91
R8214:Amph	UTSW	13	19104298	missense	possibly damaging	0.81
V1662:Amph	UTSW	13	19139370	missense	probably benign	0.36
Z1177:Amph	UTSW	13	19139334	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- TCATCACAGAAAGCATTTGACC -3'
(R):5'- CAATGTGTTAGTAAGGCTCACTTCTG -3'

Sequencing Primer
(F):5'- ACCTTTGATTTTTGGCAGTCAGAGAC -3'
(R):5'- AAAGGGGAGCATCCAATT -3'

Posted On

2020-07-13