Incidental Mutation 'R8165:Kng2'
ID633744
Institutional Source Beutler Lab
Gene Symbol Kng2
Ensembl Gene ENSMUSG00000060459
Gene Namekininogen 2
SynonymsKininogen-II
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8165 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location22985854-23029482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22987496 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 445 (S445G)
Ref Sequence ENSEMBL: ENSMUSP00000046867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039338] [ENSMUST00000100046] [ENSMUST00000115349] [ENSMUST00000160243]
Predicted Effect unknown
Transcript: ENSMUST00000039338
AA Change: S445G
SMART Domains Protein: ENSMUSP00000046867
Gene: ENSMUSG00000060459
AA Change: S445G

DomainStartEndE-ValueType
CY 18 126 3.72e-19 SMART
CY 140 248 2.57e-22 SMART
CY 262 370 2.06e-35 SMART
low complexity region 376 390 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100046
SMART Domains Protein: ENSMUSP00000097623
Gene: ENSMUSG00000060459

DomainStartEndE-ValueType
CY 18 126 3.72e-19 SMART
CY 140 248 2.57e-22 SMART
CY 262 370 2.06e-35 SMART
low complexity region 376 390 N/A INTRINSIC
low complexity region 478 506 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115349
SMART Domains Protein: ENSMUSP00000111006
Gene: ENSMUSG00000060459

DomainStartEndE-ValueType
CY 18 126 3.72e-19 SMART
CY 140 248 2.57e-22 SMART
CY 262 370 2.06e-35 SMART
low complexity region 376 390 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160243
SMART Domains Protein: ENSMUSP00000124161
Gene: ENSMUSG00000060459

DomainStartEndE-ValueType
CY 18 126 3.72e-19 SMART
Blast:CY 140 171 2e-15 BLAST
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C A 5: 63,897,946 probably null Het
1110037F02Rik T A 4: 11,542,128 D1521E probably benign Het
Amph A G 13: 19,094,837 K161E probably benign Het
Aox2 A T 1: 58,308,929 H602L probably benign Het
Areg A G 5: 91,143,633 N145S probably damaging Het
Arhgap29 C T 3: 121,988,573 T142I probably damaging Het
Bcar3 C T 3: 122,511,156 probably benign Het
Brpf3 C T 17: 28,806,274 A107V probably benign Het
Btnl2 T A 17: 34,368,708 S509T possibly damaging Het
Cacna2d2 A G 9: 107,525,454 probably null Het
Casz1 C T 4: 148,944,431 P1111L probably damaging Het
Ccdc91 C T 6: 147,631,588 T411I unknown Het
Chd9 A C 8: 91,041,141 E2422A probably damaging Het
Clrn3 T C 7: 135,528,404 I34V probably benign Het
Cnksr3 C T 10: 7,154,467 D79N probably damaging Het
Cops8 A G 1: 90,612,007 probably null Het
Cpa2 A G 6: 30,564,346 K392R probably benign Het
Dnajc28 G A 16: 91,616,907 R150* probably null Het
Dnase1l3 T C 14: 7,994,299 probably benign Het
Fam65a C A 8: 105,620,888 L1028M unknown Het
Gdpd5 A T 7: 99,456,482 T502S probably benign Het
Gp2 A T 7: 119,450,152 D387E probably damaging Het
Gpr179 A G 11: 97,351,538 L160P probably benign Het
Hmcn1 G A 1: 150,646,658 T3497M probably benign Het
Idh3b T A 2: 130,280,500 T322S possibly damaging Het
Kit A T 5: 75,620,880 N323I possibly damaging Het
Lin54 A G 5: 100,454,499 V393A probably benign Het
Lyst T A 13: 13,698,360 W2715R probably damaging Het
Mad1l1 T C 5: 140,315,058 T28A probably benign Het
Med7 T A 11: 46,441,246 C223S probably benign Het
Megf8 T A 7: 25,353,873 L1823Q probably damaging Het
Mga C A 2: 119,947,238 Q1755K probably benign Het
Mgat4b A T 11: 50,210,974 N22I probably benign Het
Ndufb6 C T 4: 40,270,665 probably null Het
Neil3 A G 8: 53,589,094 L490P probably benign Het
Nek9 C T 12: 85,303,643 V886I probably benign Het
Nol4l A T 2: 153,420,553 Y366* probably null Het
Nt5dc2 A G 14: 31,138,929 T354A probably damaging Het
Olfr339 T A 2: 36,421,703 Y102N probably damaging Het
Pde2a G A 7: 101,500,448 probably null Het
Phf1 T C 17: 26,937,070 F444L possibly damaging Het
Plin4 G A 17: 56,107,019 T202I possibly damaging Het
Plk4 G C 3: 40,813,574 V851L probably damaging Het
Pp2d1 A G 17: 53,515,229 S270P probably damaging Het
Scn9a A G 2: 66,540,530 F569L probably damaging Het
Sel1l2 T A 2: 140,262,706 L306F probably damaging Het
Spic A T 10: 88,677,566 S86T probably damaging Het
Stkld1 A G 2: 26,946,656 N278S probably benign Het
Taar7d T A 10: 24,027,597 F126I probably benign Het
Tbc1d31 A G 15: 57,960,949 E869G possibly damaging Het
Tbcd C T 11: 121,493,885 T315M probably benign Het
Terf2 T C 8: 107,083,024 K221E possibly damaging Het
Tex43 T A 18: 56,589,475 probably benign Het
Thsd7a T A 6: 12,468,963 T539S Het
Tll2 A G 19: 41,088,874 F818L possibly damaging Het
Tmem87a T C 2: 120,370,478 T427A possibly damaging Het
Ush2a C A 1: 188,451,755 Q1419K possibly damaging Het
Vill T A 9: 119,066,753 F511Y probably damaging Het
Vps13c A G 9: 67,858,790 D63G probably benign Het
Vrk2 A G 11: 26,535,575 F138L probably benign Het
Zfp710 T C 7: 80,086,027 I514T probably damaging Het
Zgrf1 T A 3: 127,563,383 F753I possibly damaging Het
Other mutations in Kng2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00851:Kng2 APN 16 23028830 missense probably damaging 1.00
IGL01319:Kng2 APN 16 23028834 missense probably damaging 0.99
IGL01469:Kng2 APN 16 22999827 missense probably damaging 1.00
IGL01681:Kng2 APN 16 22997017 splice site probably benign
IGL01830:Kng2 APN 16 22988051 missense probably damaging 0.97
IGL01903:Kng2 APN 16 22987790 missense possibly damaging 0.80
IGL02146:Kng2 APN 16 22987832 missense probably damaging 0.97
IGL02305:Kng2 APN 16 23000624 unclassified probably benign
IGL02429:Kng2 APN 16 23012079 missense probably damaging 0.99
FR4548:Kng2 UTSW 16 23000552 nonsense probably null
R0020:Kng2 UTSW 16 22997296 missense probably benign 0.02
R0047:Kng2 UTSW 16 22987563 missense possibly damaging 0.83
R0245:Kng2 UTSW 16 23012181 splice site probably benign
R0610:Kng2 UTSW 16 23000594 missense possibly damaging 0.96
R0646:Kng2 UTSW 16 22987736 missense probably benign 0.10
R0666:Kng2 UTSW 16 22997122 splice site probably benign
R1552:Kng2 UTSW 16 22987520 missense probably damaging 1.00
R1765:Kng2 UTSW 16 22988243 critical splice donor site probably null
R1833:Kng2 UTSW 16 23012052 missense possibly damaging 0.95
R1997:Kng2 UTSW 16 23024876 missense possibly damaging 0.84
R2025:Kng2 UTSW 16 23000575 missense probably benign 0.15
R2056:Kng2 UTSW 16 22987953 intron probably benign
R2137:Kng2 UTSW 16 22997326 intron probably benign
R2517:Kng2 UTSW 16 22988315 missense probably benign 0.24
R3438:Kng2 UTSW 16 23012071 missense probably benign 0.23
R3439:Kng2 UTSW 16 23012071 missense probably benign 0.23
R3551:Kng2 UTSW 16 23011995 critical splice donor site probably null
R4389:Kng2 UTSW 16 23024868 missense possibly damaging 0.91
R4538:Kng2 UTSW 16 22988063 missense probably benign 0.00
R4684:Kng2 UTSW 16 22987641 missense possibly damaging 0.93
R4978:Kng2 UTSW 16 22987916 missense probably damaging 1.00
R5658:Kng2 UTSW 16 22997020 splice site probably null
R6074:Kng2 UTSW 16 23000596 missense probably benign 0.03
R6216:Kng2 UTSW 16 22987593 missense probably damaging 1.00
R6271:Kng2 UTSW 16 23003948 missense probably benign 0.33
R6459:Kng2 UTSW 16 23012115 missense probably damaging 1.00
R7124:Kng2 UTSW 16 23012055 missense probably damaging 1.00
R7310:Kng2 UTSW 16 22987772 missense probably benign 0.00
R7532:Kng2 UTSW 16 23027044 splice site probably null
R7667:Kng2 UTSW 16 22988232 missense probably damaging 0.99
R7787:Kng2 UTSW 16 22999848 missense probably damaging 1.00
R8092:Kng2 UTSW 16 22987922 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTGCTCCTTACCAGAGCAG -3'
(R):5'- AGCCAGATAGCCTTTCATTTAAGC -3'

Sequencing Primer
(F):5'- CTCCTTACCAGAGCAGTGGATTTTG -3'
(R):5'- GCTGATATCTGATTTTCCAGAAGC -3'
Posted On2020-07-13