Incidental Mutation 'R8165:Dnajc28'
ID633745
Institutional Source Beutler Lab
Gene Symbol Dnajc28
Ensembl Gene ENSMUSG00000039763
Gene NameDnaJ heat shock protein family (Hsp40) member C28
SynonymsORF28
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8165 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location91614254-91619026 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 91616907 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 150 (R150*)
Ref Sequence ENSEMBL: ENSMUSP00000048113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023684] [ENSMUST00000049244] [ENSMUST00000133731] [ENSMUST00000143058] [ENSMUST00000156713] [ENSMUST00000169982]
Predicted Effect probably benign
Transcript: ENSMUST00000023684
SMART Domains Protein: ENSMUSP00000023684
Gene: ENSMUSG00000022962

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 6.4e-37 PFAM
GARS_A 105 298 4.42e-132 SMART
GARS_C 333 426 1.33e-44 SMART
Pfam:AIRS 473 593 1.2e-17 PFAM
Pfam:AIRS_C 606 777 9e-40 PFAM
Pfam:Formyl_trans_N 808 988 3.4e-68 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000049244
AA Change: R150*
SMART Domains Protein: ENSMUSP00000048113
Gene: ENSMUSG00000039763
AA Change: R150*

DomainStartEndE-ValueType
DnaJ 47 105 1.04e-11 SMART
low complexity region 112 123 N/A INTRINSIC
Pfam:DUF1992 203 342 4.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133731
SMART Domains Protein: ENSMUSP00000118526
Gene: ENSMUSG00000039763

DomainStartEndE-ValueType
DnaJ 47 84 6.65e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000143058
AA Change: R174*
SMART Domains Protein: ENSMUSP00000120318
Gene: ENSMUSG00000039763
AA Change: R174*

DomainStartEndE-ValueType
DnaJ 71 129 1.04e-11 SMART
low complexity region 136 147 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156713
SMART Domains Protein: ENSMUSP00000119272
Gene: ENSMUSG00000022962

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 1.4e-40 PFAM
GARS_A 105 298 4.42e-132 SMART
Predicted Effect probably null
Transcript: ENSMUST00000169982
AA Change: R174*
SMART Domains Protein: ENSMUSP00000132288
Gene: ENSMUSG00000039763
AA Change: R174*

DomainStartEndE-ValueType
DnaJ 71 129 1.04e-11 SMART
low complexity region 136 147 N/A INTRINSIC
Pfam:DUF1992 227 295 1.2e-24 PFAM
coiled coil region 312 342 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DnaJ heat shock protein family. The encoded protein, which contains a conserved N-terminal DnaJ domain, is thought to play a role in protein folding or act as a molecular chaperone protein. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C A 5: 63,897,946 probably null Het
1110037F02Rik T A 4: 11,542,128 D1521E probably benign Het
Amph A G 13: 19,094,837 K161E probably benign Het
Aox2 A T 1: 58,308,929 H602L probably benign Het
Areg A G 5: 91,143,633 N145S probably damaging Het
Arhgap29 C T 3: 121,988,573 T142I probably damaging Het
Bcar3 C T 3: 122,511,156 probably benign Het
Brpf3 C T 17: 28,806,274 A107V probably benign Het
Btnl2 T A 17: 34,368,708 S509T possibly damaging Het
Cacna2d2 A G 9: 107,525,454 probably null Het
Casz1 C T 4: 148,944,431 P1111L probably damaging Het
Ccdc91 C T 6: 147,631,588 T411I unknown Het
Chd9 A C 8: 91,041,141 E2422A probably damaging Het
Clrn3 T C 7: 135,528,404 I34V probably benign Het
Cnksr3 C T 10: 7,154,467 D79N probably damaging Het
Cops8 A G 1: 90,612,007 probably null Het
Cpa2 A G 6: 30,564,346 K392R probably benign Het
Dnase1l3 T C 14: 7,994,299 probably benign Het
Fam65a C A 8: 105,620,888 L1028M unknown Het
Gdpd5 A T 7: 99,456,482 T502S probably benign Het
Gp2 A T 7: 119,450,152 D387E probably damaging Het
Gpr179 A G 11: 97,351,538 L160P probably benign Het
Hmcn1 G A 1: 150,646,658 T3497M probably benign Het
Idh3b T A 2: 130,280,500 T322S possibly damaging Het
Kit A T 5: 75,620,880 N323I possibly damaging Het
Kng2 T C 16: 22,987,496 S445G unknown Het
Lin54 A G 5: 100,454,499 V393A probably benign Het
Lyst T A 13: 13,698,360 W2715R probably damaging Het
Mad1l1 T C 5: 140,315,058 T28A probably benign Het
Med7 T A 11: 46,441,246 C223S probably benign Het
Megf8 T A 7: 25,353,873 L1823Q probably damaging Het
Mga C A 2: 119,947,238 Q1755K probably benign Het
Mgat4b A T 11: 50,210,974 N22I probably benign Het
Ndufb6 C T 4: 40,270,665 probably null Het
Neil3 A G 8: 53,589,094 L490P probably benign Het
Nek9 C T 12: 85,303,643 V886I probably benign Het
Nol4l A T 2: 153,420,553 Y366* probably null Het
Nt5dc2 A G 14: 31,138,929 T354A probably damaging Het
Olfr339 T A 2: 36,421,703 Y102N probably damaging Het
Pde2a G A 7: 101,500,448 probably null Het
Phf1 T C 17: 26,937,070 F444L possibly damaging Het
Plin4 G A 17: 56,107,019 T202I possibly damaging Het
Plk4 G C 3: 40,813,574 V851L probably damaging Het
Pp2d1 A G 17: 53,515,229 S270P probably damaging Het
Scn9a A G 2: 66,540,530 F569L probably damaging Het
Sel1l2 T A 2: 140,262,706 L306F probably damaging Het
Spic A T 10: 88,677,566 S86T probably damaging Het
Stkld1 A G 2: 26,946,656 N278S probably benign Het
Taar7d T A 10: 24,027,597 F126I probably benign Het
Tbc1d31 A G 15: 57,960,949 E869G possibly damaging Het
Tbcd C T 11: 121,493,885 T315M probably benign Het
Terf2 T C 8: 107,083,024 K221E possibly damaging Het
Tex43 T A 18: 56,589,475 probably benign Het
Thsd7a T A 6: 12,468,963 T539S Het
Tll2 A G 19: 41,088,874 F818L possibly damaging Het
Tmem87a T C 2: 120,370,478 T427A possibly damaging Het
Ush2a C A 1: 188,451,755 Q1419K possibly damaging Het
Vill T A 9: 119,066,753 F511Y probably damaging Het
Vps13c A G 9: 67,858,790 D63G probably benign Het
Vrk2 A G 11: 26,535,575 F138L probably benign Het
Zfp710 T C 7: 80,086,027 I514T probably damaging Het
Zgrf1 T A 3: 127,563,383 F753I possibly damaging Het
Other mutations in Dnajc28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02878:Dnajc28 APN 16 91616441 missense possibly damaging 0.49
R1199:Dnajc28 UTSW 16 91618642 unclassified probably benign
R2265:Dnajc28 UTSW 16 91616312 missense probably benign 0.00
R2266:Dnajc28 UTSW 16 91616312 missense probably benign 0.00
R2276:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R2277:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R2278:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R2364:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R2366:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R2367:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R2447:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R3757:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R3890:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R4087:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R4088:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R4110:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R4112:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R4113:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R6372:Dnajc28 UTSW 16 91617288 missense probably benign 0.36
R6613:Dnajc28 UTSW 16 91616358 nonsense probably null
R8061:Dnajc28 UTSW 16 91617170 missense possibly damaging 0.70
R8163:Dnajc28 UTSW 16 91616907 nonsense probably null
R8172:Dnajc28 UTSW 16 91616907 nonsense probably null
R8174:Dnajc28 UTSW 16 91616907 nonsense probably null
Z1176:Dnajc28 UTSW 16 91617033 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- ATTCCTGAATGAGGTCCTCCAC -3'
(R):5'- GACAGCGGTTCTAGTGATGC -3'

Sequencing Primer
(F):5'- TCCACCAGGCGCTCGATG -3'
(R):5'- AGTGATGCTGACTCTGCAAC -3'
Posted On2020-07-13