Incidental Mutation 'R8165:Phf1'
ID633746
Institutional Source Beutler Lab
Gene Symbol Phf1
Ensembl Gene ENSMUSG00000024193
Gene NamePHD finger protein 1
SynonymsTctex3, Tctex-3, D17Ertd455e, mPcl1, PHF2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8165 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location26933127-26937890 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26937070 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 444 (F444L)
Ref Sequence ENSEMBL: ENSMUSP00000073402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025027] [ENSMUST00000073724] [ENSMUST00000078961] [ENSMUST00000114935] [ENSMUST00000177932] [ENSMUST00000194598] [ENSMUST00000201702]
Predicted Effect probably benign
Transcript: ENSMUST00000025027
SMART Domains Protein: ENSMUSP00000025027
Gene: ENSMUSG00000024194

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 45 60 N/A INTRINSIC
Pfam:CutA1 67 165 6.9e-44 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000073724
AA Change: F444L

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000073402
Gene: ENSMUSG00000024193
AA Change: F444L

DomainStartEndE-ValueType
TUDOR 29 86 5.61e-11 SMART
PHD 89 140 2.81e-8 SMART
PHD 188 238 2.42e0 SMART
low complexity region 410 416 N/A INTRINSIC
low complexity region 481 495 N/A INTRINSIC
Pfam:Mtf2_C 523 557 7.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078961
SMART Domains Protein: ENSMUSP00000077984
Gene: ENSMUSG00000024301

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
low complexity region 108 117 N/A INTRINSIC
low complexity region 222 240 N/A INTRINSIC
KISc 307 670 1.34e-143 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114935
SMART Domains Protein: ENSMUSP00000110585
Gene: ENSMUSG00000024194

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:CutA1 43 144 1.7e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177932
SMART Domains Protein: ENSMUSP00000137587
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
PH 27 253 3.23e-8 SMART
C2 263 362 7.4e-10 SMART
RasGAP 392 729 3.33e-118 SMART
low complexity region 787 803 N/A INTRINSIC
low complexity region 938 973 N/A INTRINSIC
low complexity region 1040 1068 N/A INTRINSIC
low complexity region 1110 1125 N/A INTRINSIC
coiled coil region 1186 1259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193200
SMART Domains Protein: ENSMUSP00000141245
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
PH 12 238 1.5e-10 SMART
C2 248 347 4.8e-12 SMART
RasGAP 377 714 2.1e-120 SMART
low complexity region 772 788 N/A INTRINSIC
low complexity region 923 958 N/A INTRINSIC
low complexity region 1025 1053 N/A INTRINSIC
low complexity region 1095 1110 N/A INTRINSIC
coiled coil region 1171 1244 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194598
SMART Domains Protein: ENSMUSP00000141686
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
PH 27 253 3.23e-8 SMART
C2 263 362 7.4e-10 SMART
RasGAP 392 729 3.33e-118 SMART
low complexity region 787 803 N/A INTRINSIC
low complexity region 938 973 N/A INTRINSIC
low complexity region 1040 1068 N/A INTRINSIC
low complexity region 1110 1125 N/A INTRINSIC
coiled coil region 1186 1259 N/A INTRINSIC
low complexity region 1308 1326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201349
SMART Domains Protein: ENSMUSP00000144666
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
RasGAP 9 346 2.2e-120 SMART
low complexity region 404 420 N/A INTRINSIC
low complexity region 555 590 N/A INTRINSIC
low complexity region 657 685 N/A INTRINSIC
low complexity region 727 742 N/A INTRINSIC
Blast:RasGAP 761 876 3e-21 BLAST
low complexity region 884 894 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201702
SMART Domains Protein: ENSMUSP00000144248
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
PH 27 253 1.5e-10 SMART
C2 263 362 4.9e-12 SMART
RasGAP 392 729 2.2e-120 SMART
low complexity region 773 789 N/A INTRINSIC
low complexity region 924 959 N/A INTRINSIC
low complexity region 1026 1054 N/A INTRINSIC
low complexity region 1096 1111 N/A INTRINSIC
coiled coil region 1171 1243 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the polycomb-like protein family, which is a component of polycomb repressive complex-2. This complex represses gene expression by catalyzing the trimethylation of histone H3 lysine 27 and is required for the regulation of developmental genes including homeotic genes. The gene is expressed primarily in testis tissue. Small interfering RNA-mediated knockdown in cultured cell lines results in changes in homeotic gene expression coincident with alterations in promoter methylation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C A 5: 63,897,946 probably null Het
1110037F02Rik T A 4: 11,542,128 D1521E probably benign Het
Amph A G 13: 19,094,837 K161E probably benign Het
Aox2 A T 1: 58,308,929 H602L probably benign Het
Areg A G 5: 91,143,633 N145S probably damaging Het
Arhgap29 C T 3: 121,988,573 T142I probably damaging Het
Bcar3 C T 3: 122,511,156 probably benign Het
Brpf3 C T 17: 28,806,274 A107V probably benign Het
Btnl2 T A 17: 34,368,708 S509T possibly damaging Het
Cacna2d2 A G 9: 107,525,454 probably null Het
Casz1 C T 4: 148,944,431 P1111L probably damaging Het
Ccdc91 C T 6: 147,631,588 T411I unknown Het
Chd9 A C 8: 91,041,141 E2422A probably damaging Het
Clrn3 T C 7: 135,528,404 I34V probably benign Het
Cnksr3 C T 10: 7,154,467 D79N probably damaging Het
Cops8 A G 1: 90,612,007 probably null Het
Cpa2 A G 6: 30,564,346 K392R probably benign Het
Dnajc28 G A 16: 91,616,907 R150* probably null Het
Dnase1l3 T C 14: 7,994,299 probably benign Het
Fam65a C A 8: 105,620,888 L1028M unknown Het
Gdpd5 A T 7: 99,456,482 T502S probably benign Het
Gp2 A T 7: 119,450,152 D387E probably damaging Het
Gpr179 A G 11: 97,351,538 L160P probably benign Het
Hmcn1 G A 1: 150,646,658 T3497M probably benign Het
Idh3b T A 2: 130,280,500 T322S possibly damaging Het
Kit A T 5: 75,620,880 N323I possibly damaging Het
Kng2 T C 16: 22,987,496 S445G unknown Het
Lin54 A G 5: 100,454,499 V393A probably benign Het
Lyst T A 13: 13,698,360 W2715R probably damaging Het
Mad1l1 T C 5: 140,315,058 T28A probably benign Het
Med7 T A 11: 46,441,246 C223S probably benign Het
Megf8 T A 7: 25,353,873 L1823Q probably damaging Het
Mga C A 2: 119,947,238 Q1755K probably benign Het
Mgat4b A T 11: 50,210,974 N22I probably benign Het
Ndufb6 C T 4: 40,270,665 probably null Het
Neil3 A G 8: 53,589,094 L490P probably benign Het
Nek9 C T 12: 85,303,643 V886I probably benign Het
Nol4l A T 2: 153,420,553 Y366* probably null Het
Nt5dc2 A G 14: 31,138,929 T354A probably damaging Het
Olfr339 T A 2: 36,421,703 Y102N probably damaging Het
Pde2a G A 7: 101,500,448 probably null Het
Plin4 G A 17: 56,107,019 T202I possibly damaging Het
Plk4 G C 3: 40,813,574 V851L probably damaging Het
Pp2d1 A G 17: 53,515,229 S270P probably damaging Het
Scn9a A G 2: 66,540,530 F569L probably damaging Het
Sel1l2 T A 2: 140,262,706 L306F probably damaging Het
Spic A T 10: 88,677,566 S86T probably damaging Het
Stkld1 A G 2: 26,946,656 N278S probably benign Het
Taar7d T A 10: 24,027,597 F126I probably benign Het
Tbc1d31 A G 15: 57,960,949 E869G possibly damaging Het
Tbcd C T 11: 121,493,885 T315M probably benign Het
Terf2 T C 8: 107,083,024 K221E possibly damaging Het
Tex43 T A 18: 56,589,475 probably benign Het
Thsd7a T A 6: 12,468,963 T539S Het
Tll2 A G 19: 41,088,874 F818L possibly damaging Het
Tmem87a T C 2: 120,370,478 T427A possibly damaging Het
Ush2a C A 1: 188,451,755 Q1419K possibly damaging Het
Vill T A 9: 119,066,753 F511Y probably damaging Het
Vps13c A G 9: 67,858,790 D63G probably benign Het
Vrk2 A G 11: 26,535,575 F138L probably benign Het
Zfp710 T C 7: 80,086,027 I514T probably damaging Het
Zgrf1 T A 3: 127,563,383 F753I possibly damaging Het
Other mutations in Phf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Phf1 APN 17 26936594 missense possibly damaging 0.90
IGL01629:Phf1 APN 17 26934273 missense probably benign 0.07
IGL01931:Phf1 APN 17 26935535 unclassified probably benign
IGL02008:Phf1 APN 17 26935286 missense possibly damaging 0.95
IGL02048:Phf1 APN 17 26934541 unclassified probably benign
IGL02206:Phf1 APN 17 26936869 unclassified probably benign
IGL02252:Phf1 APN 17 26935135 missense possibly damaging 0.65
IGL02548:Phf1 APN 17 26935626 missense probably damaging 1.00
IGL03145:Phf1 APN 17 26934370 critical splice donor site probably null
R0539:Phf1 UTSW 17 26934458 splice site probably null
R0815:Phf1 UTSW 17 26937140 unclassified probably benign
R0863:Phf1 UTSW 17 26937140 unclassified probably benign
R1028:Phf1 UTSW 17 26934333 missense possibly damaging 0.90
R1083:Phf1 UTSW 17 26937270 unclassified probably benign
R1537:Phf1 UTSW 17 26935398 critical splice donor site probably null
R1587:Phf1 UTSW 17 26937492 missense probably damaging 0.99
R1656:Phf1 UTSW 17 26937359 missense possibly damaging 0.93
R1956:Phf1 UTSW 17 26935745 splice site probably null
R2566:Phf1 UTSW 17 26937088 missense probably damaging 1.00
R3196:Phf1 UTSW 17 26934455 missense probably damaging 1.00
R4223:Phf1 UTSW 17 26937500 nonsense probably null
R4835:Phf1 UTSW 17 26934678 missense probably benign
R6439:Phf1 UTSW 17 26936612 missense probably benign
R7070:Phf1 UTSW 17 26934333 missense possibly damaging 0.90
R7289:Phf1 UTSW 17 26935315 missense probably damaging 1.00
R7846:Phf1 UTSW 17 26935317 nonsense probably null
X0028:Phf1 UTSW 17 26936188 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CAGACTCTGTCACCTGCAACTC -3'
(R):5'- TGTGAAGTCCCAGAGGTGAC -3'

Sequencing Primer
(F):5'- GACTCTGTCACCTGCAACTCTTTTC -3'
(R):5'- TCCCAGAGGTGACCTGGAAG -3'
Posted On2020-07-13